tag:blogger.com,1999:blog-24624086703978374212024-03-13T08:32:33.779-07:00How to write argument essayEssay Topics For Class 7 In Hindithersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.comBlogger182125tag:blogger.com,1999:blog-2462408670397837421.post-45501413086264049702020-09-04T04:29:00.001-07:002020-09-04T04:29:14.365-07:00Ethnographic Reaction PaperEthnographic Reaction Paper The Cheyenne individuals The Cheyenne individuals allude to the American Indians whose genealogical land lies on the western side of the Mississippi waterway. Financially they are pastoralists, trackers and finders. Socially, they live in towns while the network has factions, which separate the families.Advertising We will compose a custom article test on Ethnographic Reaction Paper explicitly for you for just $16.05 $11/page Learn More Politically, they have inborn chambers, which guarantee harmony inside the network. The following conversation sums up the social, social, monetary and political structures of the Cheyenne Indians, clarifying the effect of European investigation on their way of life. The Cheyenne Indians relocated to new places contingent upon their necessities. For example, financial undertakings like exchange and chasing, attack of their territory by the whites, and their itinerant way of life likewise impelled them to change their residences every now and again (Ho ebel 4). As indicated by the anthropological information, the Cheyenne Indians had diverse ID or names, which relied upon the individuals they experienced. A portion of the names used to allude to them incorporate, Chaa, Shahiyena and Shahiela among others (Hoebel 2). Contingent upon the territory of settlement, all the names had implications. At first, they relocated from their familial land for exchanging purposes. La Salle, a French pilgrim, was one of the men they depended on to start exchanging exercises their locale. In any case, in light of absence of instruments utilized in shaving creature hide, they needed to look for help from the European makers. Notwithstanding relying upon the game meat, they additionally made due on wild rice from the close by stream, just as organic products from the close by backwoods. They built their homes utilizing earth and barks of tree. Then again, some outer powers like war with different networks or clans like Ojibwa, Ute, Comanche, Kiowa an d Chippewa urged them to, structure military gatherings, yet additionally procure ponies and weapons for resistance purposes (Hoebel 8).Advertising Looking for exposition on human studies? How about we check whether we can support you! Get your first paper with 15% OFF Learn More Luckily, when the United States interceded on the regional issue, it isolated the Cheyenne Indians into two gatherings the Southern and Northern relying upon their area. The Cheyenne Indians had such huge numbers of social functions like the recharging of the bolt, which takes four days to finish. The Cheyenne Indians had medication men and boss clerics who managed the vast majority of the network ceremonies (Hoebel 20). The recharging of the holy bolt advanced solidarity among the individuals, blessed them and lectured the individuals to regard the standards of the network for their success. Besides, it was to stress the exceptional forces and the predominance of the main clerics and the prophets in the ne twork. Furthermore, the sun move is an image of virtue or new world. The ceremonial takes around eight days. Every day has unmistakable custom that individuals ought to perform. A portion of the trademarks in the function incorporate the multiplier, the erect horns and the sacrosanct mountain. The third service is the creature move, which guarantees the achievement of the chasing exercise, just as triumph during wars. The function takes around four days. In any case, dissimilar to the bolt reestablishment function, ladies have a task to carry out during the custom procedure. Socially, a family was an unmistakable structure in the way of life. The direct of young ladies and ladies was the focal point of the family. Pre-adult young ladies and young men didn't partner to guarantee virtue among young ladies. Admirers could just move toward young ladies however not entice them. In this manner, there were severe principles and guidelines concerning relationships and settlement was a compu lsory practice. There was a division of families relying upon their societal position. Property possession, the character of both the female and male individuals in the family and the capacity to assault different networks are a portion of the highlights, which classified a composite family as either rich or poor.Advertising We will compose a custom exposition test on Ethnographic Reaction Paper explicitly for you for just $16.05 $11/page Learn More There was Kinship in the family and the family conventions and standards, which the family needed to maintain carefully. The men were the tops of the families and ladies must be compliant. Ladies who veered off from the ordinary customs needed to confront discipline through whipping or suspension. There was a division of the families into Kindred, camps or groups relying upon the quantity of individuals/essential or families present. Every division spreads out guidelines on, which the individuals need to maintain. The related and camps s tructure military work force whose principle job is to ensure the network against outer attack. A portion of the military structures included Elk, fox, shield and bowstring. The military gatherings had an alternate number of warriors with a specific task to carry out inside the general public. What's more, there was an inborn chamber, which directed all the social, monetary and political exercises of the network. The committee of boss explained both inward and outside clashes. They additionally guaranteed that harmony won in the network. The boss had certain ethics like liberality, solidarity and shrewd among others, which qualified them as pioneers. Moreover, the Cheyenne Indians had open laws, which helped with tackling the interior and facades clashes. The laws guaranteed there was solidarity in the network by taking care of the inside issues. The greater part of the cases included homicide cases, conjugal issues, clashes over property and social. The law and equity structure con sidered changing of the current laws, authorization of the societyââ¬â¢s law and the utilization of military work force and passing equity. There was a differentiation on the jobs of ladies and men and seldom mistaken assumptions resulted between the gatherings. Ladies were resource ranchers who gave vegetables and different types of grains while men were trackers and finders. The requirement for chasing ground consistently raised hostility between Cheyenne Indians and their neighbors. Thusly, the network imparted military strategies and courage among its men to advance victory.Advertising Searching for exposition on human studies? How about we check whether we can support you! Get your first paper with 15% OFF Find out More In spite of the fact that they had sub-par weapons contrasted with their foes, the Cheyenne troopers consistently indicated boldness as a result of the prize that lie ahead on any triumphant fight out successful. As prior referenced, the Cheyenne Indians had strict and ceremonial practices. They had strict men like the medication men who directed both conventional practices and petitions. All the social and strict practices were sacrosanct as well as polished in consecrated spots like on specific mountains. The social and social practices illuminated the character of the two people. In the mid to late nineteenth century, the Americans wayfarers, brokers and teacher attacked the Cheyenne Indians residence, which prompted changes in their way of life (Hoebel 119). The nearness of whites and the mining of gold prompted the episode of maladies like cholera. After the war, the Cheyenne Indians marked a settlement in 1851 with the whites. In any case, after two years, a war followed and th ere was marking of the second arrangement in 1861 stronghold insightful settlement (Hardorff 20). The bargains meddled with the social, financial and legislative issues structures of the locals since they needed to live under the standard of the Americans. Other than cultivating and instruction, they likewise needed to receive Christianity relinquishing their way of life. Their dressing styles and dialects changed because of the intrusion of the Americans. Expressly, finding out about the Cheyenne Indians has illuminated me on their customary practices, way of life and political structures. Other than being the locals of the Western side of the Mississippi waterway, they are additionally among the notable individuals in the American history. In the first place, I have found out about the purposes behind their relocation from the tribal terrains and they incorporate quest for new chasing grounds, experience and after outer attack from different networks. Monetarily, they depended on game meat, wild natural products, vegetables and wild rice for food. Second, the family is the most persuasive social structure among the Cheyenne Indians and every relative had a novel task to carry out. A portion of the social practices were additionally strict customs. The political structure incorporates the ancestral committee, law and equity and the military gathering. Be that as it may, the intrusion of the whites didn't just meddle with their social, financial and political settings yet in addition constrained them to gain new monetary practices like metal forger. Christianity assumed control over their conventional customs and religion. In the contemporary society, the Cheyenne Indians consider themselves the morning star individuals and monetarily they have enormous stops of coal utilized for age of power. At long last, through prehistoric studies, the historical backdrop of the Cheyenne Indians is obvious to the contemporary world (Haviland et al. 10) as it is the situati on in the above conversation. Generally, the Cheyenne Indians are among the locals of the United States of America. Other than their itinerant way of life, the intrusion of the whites into their country didn't just upset their social legacy yet in addition changed their financial, political and social highlights. Be that as it may, in the contemporary society globalization has absolutely meddled with their way of life. Hardorff, Richard. Cheyenne recollections of the Custer battle. Nebraska: University ofà Nebraska Press, 1998. Print. Haviland, William, Harald, Prins, and Walrath, Dana. The Essence of Anthropology.à United State: Wadsworth Publishing Company, 2009. Print. Hoebel, Adamson. The Cheyennes: Indians of the Great Plains (Case Studies inà Cultural Anthropology. US: Wadsworth Company, 1978. thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-10066490370681730662020-08-25T16:53:00.001-07:002020-08-25T16:53:09.670-07:00Total computer Inc Case Study Example | Topics and Well Written Essays - 250 wordsAll out PC Inc - Case Study Example Despite the fact that he expresses that the cash demonstrated is right, he doesn't express the specific cash. For this affirmation to be utilized in altering extra data from archives that show that the exchange occurred, for example, money receipts and conveyance records. In the last model, the inspector didn't get an affirmation reaction by email. This required the endeavor of extra methods, for example, assessment of money receipts and the agreement between Total Computer Inc and Dot. Bomb Inc. These extra strategies helped in masterminding installments and adjusting procedural issues where there was an infringement of the agreement between these two organizations. When managing money due equalizations, assessment of the all around expressed affirmation records are satisfactory for reviewing. Notwithstanding, in situations where the reviewer isn't in a situation to get the affirmation messages, extra methods can be completed. These are archives that demonstrate the presence of the exchange or the attestation. This extents from money receipts, transporting documentation and others that show that the exchange took thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-91089992806364608602020-08-22T21:51:00.001-07:002020-08-22T21:51:38.883-07:00Should The Pin-Up Photographs And Calendars Have Been Taken Down Essay - 1Should The Pin-Up Photographs And Calendars Have Been Taken Down - Essay Example This authorââ¬â¢s sentiment is that the pin-up photos and schedules ought to have been brought down. In any case, it would have been progressively judicious to convey to representatives why they would be brought down. A basic explanation could be that individual pin-up photos and schedules, or some other individual banner so far as that is concerned, are not permitted in the work environment as an employerââ¬â¢s rule. The work environment is, all things considered, the employerââ¬â¢s property. It might likewise be contended that the pin-up photos and schedules make an explicitly antagonistic condition for ladies, as it accomplished for Barbara Hill. A lady isn't required to work in an explicitly threatening workplace when she accepts a position where a large portion of her associates are men. She has the privilege to work in a situation liberated from lewd behavior and she is qualified for work where female representatives are not made awkward in view of their sex. These mig ht be the very reasons why the manager chose to bring down the pin-up photos and schedules, just as shared Barbara Hill's perspectives with respect to them. The boss may have trusted it in his capacity or power to bring down the hostile materials. In any case, albeit as indicated by Chambers, explicitly interesting or unequivocal photographs can be utilized to help an unfriendly situation guarantee, he likewise battles that threatening condition law includes divergent treatment, not dissimilar effect. Funk, in this way contends there is no legal help for precluding realistic portrayals in the working environment as long as no sexual orientation is was caused to feel mediocre or rewarded in an unexpected way. thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-20238461424330478942020-08-22T05:10:00.001-07:002020-08-22T05:10:25.997-07:00Is consociational democracy democratic EssayToday, popular government is both an inescapable nearness and an esteemed image in European politics1. Scholars of the idea for the most part concede to the essential standards of vote based system yet have would in general contrast drastically in their origination of famous principle and just practices2. Subsequently, it was fairly inescapable that majority rule government as a perfect rose in various structures over the differing social orders common in Western Europe. Arend Lipjpharts fundamental work on Ëconsociational democracies3 added to law based hypothesis concerned principally with political solidness of law based systems in plural societies4. The vote based reasonability of Lipjpharts hypothesis has as of late been raised doubt about however5. What at that point is Ëdemocracy? Setting up the benchmarks of the idea at the start will permit us to assess the degree to which Ëconsociational vote based system can be viewed as Ëdemocratic. An evaluation of the key subjects of Lipjpharts hypothesis that of Ëgrand alliances, Ësegmental self-governance, Ëproportionality and Ëminority veto separately will set the structure to the accompanying conversation. Drawing models from the Belgian and Swiss Ëconsociational systems will give delineations of the rising contention that consociational vote based system is undemocratic6. Abraham Lincoln broadly portrayed the idea of Ëdemocracy as Ëgovernment of the individuals, by the individuals, for the people7. Lincolns conspicuous expression embodies three basic standards, which, generally interpreted, imply that we as residents administer through ideological groups speaking to our inclinations; practice our decision through establishment to choose those in charge; and reserve the privilege to consider people in power responsible for their activities. Additionally, the fourth striking trademark noted by scholastics is that majority rule government speaks to political stability8. For Lipjphart, Å"consociational vote based system implies government by tip top cartel intended to transform a vote based system with a divided political culture into a stable democracy 9. ËGrand alliances would be utilized to keep social decent variety from being changed into Å"explosive social segmentation 10. Legislative issues, by its very nature, benefits from clashes emerging from social heterogeneity11 and the steadiness of isolated social orders frequently relies upon whether the elites of opponent subcultures are willing and ready to dismiss encounter for compromise12. A great alliance empowers political pioneers of the considerable number of portions of the plural society to mutually oversee the country13. Nobel prize winning market analyst Sir Arthur Lewis supports the framework by contending that all who are influenced by a choice ought to get the opportunity to take part in settling on that choice, in light of the fact that Å"to bar losing bunches from cooperation unmistakably disregards the essential importance of democracy 14. In this sense, by grasping the idea of fabulous alliance, consociationalism can be supposed to be Ëdemocratic15. There is, in any case, proof to recommend that by and by the standard of Ëgrand alliance doesn't cling near the benchmarks of vote based system. The Belgian administrative field has generally speaking remained genuinely shut to non-column parties, which appears to repudiate the very embodiment of terrific alliance government16. In Switzerland, despite the fact that the significant gatherings are spoken to on generally corresponding grounds in the Federal Council, the agents are not generally those named by the party17. Does this falsehood easily with the underlying origination of vote based system as government Ëof the individuals? Who cares about accountability? Since the Federal Council settles on its choices in a collegial way, no gathering can hold its agent government legitimately responsible18. The Swiss consociational framework can't along these lines be supposed to be really responsible to the electorate in spite of one of the essential standards of democracy19. Additionally, the Swiss submission framework has regularly featured defects innate in a Ëgrand alliance. Despite the fact that the result of an approach choice is one of Ëamicable understanding among the first class, it may be restricted by 49% of the electorate at referendum20. Papadopoulos contends that the serious issue originates from the way that, since certain choices are taken toward the finish of the procedure by mainstream vote, it adequately avoids any further intrigue or bargaining21. Can the Ëgrand alliance framework really concur with the fair guideline of representativeness if restricting aggregate choices might be taken on little well known majorities?22 Furthermore, since pleasing techniques are not generally viable, they are all the more effectively gridlocked23 and conceivably unstable24. Therefore, it appears that first class convenience doesn't satisfy its proposed settling capacity and in this way doesn't adjust to a definitive suggestion of equitable steadiness. In all popular governments power is essentially isolated to certain degrees between the focal and non-focal governments so as to maintain a strategic distance from a centralization of power25. The Ëconsociational school, propelled by the works of Tocqueville, considers decentralization to be power as the quintessence of popularity based government26. The rule of Ësegmental independence tries to guarantee that dynamic authority is, however much as could reasonably be expected, assigned to the different developments of society while issues of regular intrigue are chosen together. Interestingly with larger part rule, it might be described as Å"minority rule over the minority itself in issues that are their elite concern 27. This follows from Jan-Erik Lanes recommendation that every single cultural gathering will regard the guidelines of vote based system on the off chance that they have self-governance over their own affairs28. Federalism is the most popular technique for giving segmental self-sufficiency to various gatherings in the public arena. Segmental self-governance may likewise be given on a non-regional premise which is of specific importance to plural social orders where unmistakable sub-social orders are not geologically thought. Such non-regional self-rule described the Belgian framework preceding its change into a government state in 1993. Switzerland is likewise a bureaucratic state wherein power is partitioned between the focal government and various cantonal governments. The two frameworks, as indicated by Tocquevilles examination, are helpful for vote based system. It is obvious that one of the auxiliary qualities of segmental self-sufficiency as federalism is that the littler segment units are overrepresented in the government chamber a lot of administrative seats surpasses a lot of the population29. The most extreme augmentation of this guideline is by all accounts equity of portrayal paying little heed to the part units populace. Such equality is apparent in Switzerland where two agents represent each canton. Could an overrepresentation of minorities be genuinely law based on the off chance that it ignores the desire of the dominant part? Also, the structure segmental self-rule takes in the Netherlands is that column associations in zones, for example, training, social insurance and lodging are perceived and financed by the administration. Every association has significant impact in the running of their arrangement part, yet the expanding mediation of the state in forcing guidelines implies that Å"the associations that are self-sufficient in name are, by and by, semi legislative agencies 30. In this way, it tends to be contended that the columns are to a degree not, at this point fairly illustrative of the social orders they represent. What of vote based dependability? In the Swiss setting, exceptionally decentralized federalism has been blamed for being an obstacle of viable government31 and Belgiums new arrangement of administrative consociationalism is bipolar, which isn't generally a decent condition for its smooth operation32. Å"There can be no uncertainty that the appropriation of an arrangement of chose authoritative officials has a most indispensable impact during the time spent democracy 33. The idea of Ëproportionality fills in as the essential standard of political representation34. The standard of proportionality, said to be so vital to the Ëpolitics of settlement, endeavors to guarantee that all gatherings approach state resources35. For sure, it appears that if divided clash is multi-dimensional, a two-party framework must be viewed as a Å"electoral restraint that can scarcely be viewed as justly better than a multi-party framework mirroring the entirety of the significant issue alternatives 36. Besides, in two-party frameworks the gathering increasing a general greater part will in general be overrepresented in parliament, though casts a ballot convert into seats relatively through the reception of corresponding representation37. The Swiss consociational framework, makes portrayal a stride further through referenda, whereby the general population viably have a veto on state policy38. Hence, with respect to portrayal, doubtlessly consociational vote based system procures the higher just ground. Then again, regardless of whether we yield that Ëproportionality is increasingly Ërepresentative, it is certain that a characterizing normal for consociational majority rules system is the nonappearance of rivalry since the battling is aimed at the preparation of the sub-social supporters, not at rivalry with different gatherings. Rivalry between parties is, be that as it may, a characterizing highlight of democracy39, coming from the thought of opportunity and decision. Will non-rivalry be compared with nonappearance of decision and along these lines be viewed as undemocratic? Alternately, certain scholastics have contended that in its unadulterated structure the arrangement of relative portrayal Å"generally reverse discharges and may end up being the kiss of death 40. In reality, party volatilities may have huge ramifications for the political procedure in consociational democracies41. The Swiss party framework is exceptionally fragmented42, and the expanding fractionalisation of the gathering framework in Belgium has prompted high unpredictability decisions and instability43. Does this hold fast to the majority rule idea of security? Additionally, in the Swiss setting it might be contended that choices are fundamentally majoritarian in their belongings, since they are normally chosen by thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-23579282801325020042020-08-21T19:33:00.001-07:002020-08-21T19:33:23.767-07:00Suppliers Relationship at Pfizer Essay Example | Topics and Well Written Essays - 2000 wordsProviders Relationship at Pfizer - Essay Example As of third quarter of 2010, the organization announced its all out income of $16.2 billion regardless of the monetary downturn in certain pieces of the world (Pfizer, 2010 c). This figure is 39% more than the all out income of Pfizer during the third quarter of 2009. (See Table I â⬠Comparison between Pfizerââ¬â¢s third Quarter Revenue somewhere in the range of 2009 and 2010 underneath) before, dominant part of the buyers are scanning for a wide-scope of wellsprings of crude materials given that the provider can offer the organization the most reduced market cost for a similar item (Gadde and Hakansson 1993, pp. 165 â⬠166). Today, buyers are after the need to build up a drawn out cooperative relationship with its providers so as to benefit less expensive excellent crude materials (Chobra and Meindl 2001; Araujo, Dubois and Gadde 1999; Bensaou 1999). According to the business development of Pfizer, this report wide-scope of will examine about the significance and ways on th e most proficient method to appropriately deal with the flexibly side of crude materials by setting up a decent connection with its providers. Beside talking about the various degrees of association in which Pfizer can build up great connection with its providers, this report will examine a few methodologies that will empower Pfizer keep up a solid and enduring relationship with its licensed providers. Provider relationship the board has been a typical practice in flexibly chain the executives of global organizations like Pfizer. As clarified by Wisner, Tan and Leong (2009, p. 95). thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-30029609382986088722020-08-06T16:50:00.001-07:002020-08-06T16:50:03.462-07:00Psychiatric Hospitalization for Troubled TeensPsychiatric Hospitalization for Troubled Teens Theories Behavioral Psychology Print Psychiatric Hospitalization for Troubled Teens By Amy Morin, LCSW facebook twitter instagram Amy Morin, LCSW, is a psychotherapist, author of the bestselling book 13 Things Mentally Strong People Dont Do, and a highly sought-after speaker. Learn about our editorial policy Amy Morin, LCSW Updated on September 20, 2019 Tetra Images/Getty Images More in Theories Behavioral Psychology Cognitive Psychology Developmental Psychology Personality Psychology Social Psychology Biological Psychology Psychosocial Psychology Psychiatric hospitals provide the highest level of treatment available to teens and are intended for the short-term stabilization of serious mental health issues. A hospital setting provides a locked environment with constant clinical supervision to ensure their safety. When Is a Psychiatric Hospital Needed? Similar to a hospital for physical problems, a psychiatric hospital is set up to deal with mood or behavioral changes that come on suddenly and require intense structure and intervention to keep the teen safe. Situations Requiring Hospitalization Suicide attempt Threatening someone with a weaponHallucinationsUncontrollable physical rage Manic episodes Teens require different treatment from adults. So its important for teens to be placed on an adolescent unit where the ?staff is trained in dealing with younger patients. Transporting Troubled Teens to Treatment Treatment in an Adolescent Psychiatric Hospital The two most important things to know about psychiatric hospitals are: The treatment is fast-paced and intense. The length of stay will be very short, usually several days. Hospitals for mental health issues are intended to thoroughly evaluate the crisis, act quickly to stabilize the teen and develop a plan for continued care. A comprehensive evaluation begins at the time of admission and is completed by interviewing the teen, family members and mental health or school professionals who have worked with the teen and can provide relevant information. This assessment considers the prior history of problems in mood or behavior, use of drugs or alcohol, previous treatment, physical illness or symptoms, and family history of mental illness. Hospitals use a treatment team approach with an extensive staff of professionally trained personnel. Team members may include psychiatrists, psychologists, substance abuse counselors, therapists, social workers, nurses, activity therapists, teachers and more. Professionals from each discipline evaluate the teen and make recommendations for treatment both in the hospital and after discharge. While in the hospital teens participate in numerous daily structured activities to include: Psychological testingIndividual therapy Group therapy with other hospitalized teensAcademic programs to help keep up with schoolOccupational, recreational and art therapies Family therapy focused on immediate concerns and next stepsMulti-family groups - many hospitals suggest families continue in these groups as part of aftercare Psychological Evaluations for Troubled Teens Discharge Planning Discharge planning refers to specific plans made for the aftercare or follow-up treatment the teen will participate in upon leaving the hospital. Depending on how well the teen responds to treatment in the hospital, follow-up programs will be recommended. Some teens may require residential treatment, while others may benefit from day treatment. If medication and efforts at stabilization create significant changes then a lower level of care such as an alternative school or intensive outpatient therapy may be appropriate. Once the reasons for the crisis are identified and a teen is considered stable by the treating psychiatrist and hospital staff, a case manager will work on the discharge plan. A case manager works with parents on setting up aftercare services. Referrals to a therapist, psychiatrist, or other service providers will be made. Usually, a case manager will set up follow-up appointments to ensure that the teen remains healthy once shes discharged home. Sometimes, parents feel like a teen is being rushed out of the hospital. They fear their teen hasnt recovered enough or they worry that safety issues arent completely resolved. Its important to make sure you have a clear understanding of your teens discharge instructions; and follow-up with ongoing service providers to keep your teen mentally healthy. Unfortunately, short stays are the reality of psychiatric hospitals. They are expensive to operate and are intended to assess the teen, stabilize the crisis and provide expertise in helping transition the teen into a less intensive program. Support Groups for Parents of Troubled Teens thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-49581172417013640142020-06-25T14:37:00.001-07:002020-06-25T14:37:03.600-07:00EENT Blueprint Welcome to episode 33of the FREE Audio PANCE and PANRE Physician Assistant Board Review Podcast. Join me as I continue tocover topic specific PANCE and PANRE review from the Academy course content following the NCCPA content blueprint. This week we will be covering 10 topic specific EENTboard review questions. Eyes, Ears Nose and Throat accounts for 9% of your PANCE/PANRE board exam. Below you will find an interactive exam to complement the podcast. I hope you enjoy this free audio component to the examination portion of this site. The full EEMTreview includes over 111 EENTspecific questions andis available to all members of the PANCE and PANRE Academy. You can download and listen to past FREE episodes here,oniTunesor StitcherRadio. You can listen to the latest episode, take an interactive quizand download your results below. Listen Carefully Then Take The Quiz If you can't see the audio player click here to listen to the full episode. EENTPANCE and PANREPodcast Quiz The Audio PANCE and PANRE EENT Quiz 1 Please wait while the activity loads. If this activity does not load, try refreshing your browser. Also, this page requires javascript. Please visit using a browser with javascript enabled. If loading fails, click here to try again Start Question 1A 4 year-old child presents with a rapid onset of high fever and extremely sore throat. Which of the following findings are suggestive of the diagnosis of epiglottitis?ACroupy cough and droolingBThick gray, adherent exudateHint: Thick gray adherent exudate is suggestive of diphtheria.CBeefy red uvula, palatal petechiae, white exudate Hint: Beefy red uvula, palatal petechiae, and white exudate are findings suggestive of streptococcal pharyngitis.DInflammation and medial protrusion of one tonsilHint: Inflammation with medial protrusion of the tonsil is suggestive of a peritonsillar abscess.Question 1 Explanation: A croupy cough with drooling in a patient who appears very ill is consistent with epiglottitis. Examining the throat is contraindicated, unless the airway can be maintained.Question 2Which of the following are normal findings in a Weber test?AThe tympanic membrane is movable with pneumatic otoscopy.Hint: A movable tympanic membrane indicates there is no effusion, and is not the Weber test. BThe tympanic membrane is pearly gray with a sharp cone of light with apex at the umbo.Hint: The tympanic membrane is evaluated by direct observation with an otoscope, and is not the Weber test.CSound is heard equally in both ears when a vibrating tuning fork is placed on the mid forehead. DAir conduction is greater than bone conduction when a vibrating tuning fork is moved from the mastoid bone to close to the ear canal.Hint: A normal Rinne test means that tuning fork vibration is heard longer through the air than the bone.Question 2 Explanation: A normal Weber test means there is no lateralization of sound perception when a vibrating tuning fork is placed on the mid forehead.Question 3Which of the following is diagnosed by use of the cover/uncover test?AAdie's pupilHint: Adie's pupil is a sluggish pupil reaction to light and accommodation, evaluated by papillary reaction to light.BStrabismus CGlaucoma Hint: Tonometry is used to measure intraocular pressure to evaluate for glaucoma.DMyopiaHint: Myopia is evaluated by using a Snellen chart.Question 3 Explanation: The cover/uncover test is used to diagnose strabismus.Question 4A 45 year-old male complains of loss of hearing in his left ear. He also complains of ringing in the ear, and has had occasional dizziness. On exam, there is unilateral left-sided sensorineural hearing loss and a diminished corneal reflex. Neuro exam is otherwise normal. TMs are normal, and canals are clear. Neck is supple, without adenopathy. Oropharynx is normal. Of the following, the best diagnostic study to identify the cause of this patient's complaints isAauditory brainstem evoked response. Hint: See B for explanation.Bgadolinium-enhanced MRI.Cacoustic reflex testing.Hint: See B for explanation. Dvestibular testing.Hint: Vestibular testing is not a useful screening test for acoustic neuromas.Question 4 Explanation: MRI has replaced auditory brainstem evoked response and acoustic reflex testing in the evaluation of patients for acoustic neuromasQuestion 5A 23 year-old graduate student presents with sudden onset of severe dizziness, with nausea and vomiting for the past couple of hours. She denies hearing loss or tinnitus. She has had a recent cold. Which of the following is the most likely diagnosis?AMà ©nià ¨re's diseaseHint: Mà ©nià ¨re's disease is associated with hearing loss, tinnitus, and vertigo that lasts from seconds to hours.BVestibular neuronitisCBenign positional vertigoHint: Benign positional vertigo occurs with changes in position, especially rapid movements of the head. Nausea may occur, but vomiting is not significant.DVertebrobasilar insufficiencyHint: Vertebrobasilar insufficiency is usually accompanied by brain stem findings, such as diplopia, dysarthri a, or dysphagia, and is not common in this age group.Question 5 Explanation: Vestibular neuronitis or labyrinthitis presents with vertigo, nausea, and vomiting, but not hearing loss or tinnitus. It is related to viral URIs, and develops over several hours, with symptoms worse in the first day, with gradual recovery over several days.Question 6A 4 year-old boy presents with purulent, foul-smelling nasal discharge for three days. He has not had any other symptoms of respiratory illness, cough, wheeze, or fever. His activity level and appetite has been normal. On exam, he is afebrile. TM's have normal light reflex, canals are clear. Left nare is clear; there is considerable amount of purulent exudate from the right nare, and a bright reflection of light is noticed. Oropharynx is without inflammation or exudate. Neck is supple, without lymphadenopathy. Lungs are clear, with equal breath sounds and no wheezing. Heart has regular rhythm without murmurs. Which of the following is the most likely diagnosis?AViral URIHint: Viral URI does not present with foul-smelling nasal discharge.BAcute sinusitisHint: Acute sinusitis may present with purulent nasal discharge, but the observation of a bright light reflection suggests a foreign body.CAllergic rhinitisHint: Allergic rhinitis is seasonal, associated with sneezing and other allergy-related symptoms. DNasal foreign bodyQuestion 6 Explanation: Nasal foreign body is suggested by unilateral nasal obstruction or discharge.Question 7A 59 year-old male complains of "flashing lights behind my eye" followed by sudden loss of vision, stating that it was "like a curtain across my eye." He denies trauma. He takes Glucophage for his diabetes mellitus and atenolol for his hypertension. He has no other complaints. On funduscopic exam, the retina appears to be out of focus. Which of the following is the most likely diagnosis?ACentral retinal vein occlusionHint: Central retinal vein occlusion causes painless, variable loss of vision. Ex am shows retinal hemorrhages in all quadrants and edema of the optic disk.BRetinal artery occlusionHint: Retinal artery occlusion presents with sudden, painless loss of vision. Exam shows pale retina with normal macula, seen as a cherry-red spot.CRetinal detachmentDHyphemaHint: Hyphema is usually associated with trauma, and is a collection of blood in the anterior chamber.Question 7 Explanation: Patients with retinal detachment frequently complain of flashes of light or floaters that occur during traction on the retina as it detaches. This is followed by loss of vision. In small detachments, the retina may appear out of focus, but with larger detachments, a retinal fold may be identified.Question 8A 64 year-old woman complains of headache and left eye pain for about a day. She says it started yesterday as a dull ache and now is throbbing. She also complains of nausea and vomiting, which she attributes to the popcorn she ate at the movie theater yesterday afternoon. On exam, the left pupil is mid-dilated and nonreactive. The cornea is hazy. A ciliary flush is noted. Which of the following is the most likely diagnosis?AMigraine headacheHint: Migraine headache does not present with eye findings.BTemporal arteritisHint: Temporal arteritis presents with headache and systemic symptoms of fever, myalgias, anorexia, and tenderness over the temporal artery.CAcute glaucomaDRetinal artery occlusionHint: Retinal artery occlusion presents with sudden, painless, severe loss of vision. There are no systemic symptoms.Question 8 Explanation: Acute glaucoma often presents with abdominal complaints that may delay diagnosis. Findings of ciliary flush, mid-dilated and nonreactive pupil, and hazy cornea in a patient with severe eye pain are consistent with acute angle closure glaucoma.Question 9The most reliable sign of acute otitis media (AOM) isAbulging of the tympanic membrane.Hint: Bulging and air bubbles behind the TM represent OM with effusion.Bloss of tympanic membrane mobil ity.Creddening of the tympanic membrane.Hint: Reddening of the eardrum is not reliable as it may be due to crying or other vascular changes. Dair bubbles behind the tympanic membrane.Hint: See A for explanation.Question 9 Explanation: Loss of tympanic membrane mobility during pneumoinsufflation is the most reliable sign for diagnosing acute otitis media.Question 10A patient presents with eye pain and blurred vision. Snellen testing reveals vision of 20/200 in the affected eye and 20/20 in the unaffected eye. Fluorescein staining reveals the presence of a dendritic ulcer. Which of the following is the most likely diagnosis?AViral keratitisBFungal corneal ulcerHint: Fungal corneal ulcers have an indolent course with intraocular infection being common but fluorescein staining is negative for a dendritic pattern.CAcanthamoeba keratitis Hint: Acanthamoeba keratitis has a waxing and waning course over several months and has no fluorescein staining in a dendritic pattern.DBacterial corneal ulcerHint: Bacterial corneal ulcers can progress aggressively resulting in corneal perforation. Fluorescein staining does not occur in a dendritic pattern.Question 10 Explanation: Herpes Simplex virus is a common cause of dendritic ulceration noted on fluorescein staining.Question 11Small grayish vesicles and punched-out ulcers in the posterior pharynx in a child with pharyngitis is representative of which organism?AEpstein-Barr virusHint: Epstein-Barr virus presents with enlarged tonsils with exudates and petechiae of the palate.BGroup C Streptococcus Hint: Group C Streptococcus presents with a red pharynx and enlarged tonsils with a yellow, blood tinged exudates CCoxsackievirusDGonorrheaHint: Neisseria gonorrhea of the pharynx may be asymptomaticQuestion 11 Explanation: Coxsackievirus presents with small grayish vesicles and punched-out ulcers in the posterior pharynx. There are 11 questions to complete. List Return Shaded items are complete. 1234567891011 Return You have completed questions question Your score is Correct Wrong Partial-Credit You have not finished your quiz. If you leave this page, your progress will be lost. Correct Answer You Selected Not Attempted Final Score on Quiz Attempted Questions Correct Attempted Questions Wrong Questions Not Attempted Total Questions on Quiz Question Details Results Date Score Hint Time allowed minutes seconds Time used Answer Choice(s) Selected Question Text All doneNeed more practice!Keep trying!Not bad!Good work!Perfect! Looking for all the podcast episodes? This FREE series is limited to every other episode, you can download and enjoy the complete audio series by joiningThe PANCE and PANRE Exam Academy. I will bereleasing new episodes every few weeks. The Academy isdiscounted, so sign up now. Resources and Show Notes: My list of recommended PANCE and PANRE review books My secretly hidden 50 Question EENT Board Review (HINT IT IS FREE) Click Here USE CODE PALIFE TO GET 10% OFF THE RUTGERS PANCE AND PANRE REVIEW COURSE This Podcast is also available on iTunes and Stitcher Radio for Android iTunes:The Audio PANCE AND PANRE Podcast iTunes Stitcher Radio:The Audio PANCE and PANRE Podcast Stitcher document.createElement('audio'); http://traffic.libsyn.com/pasquini/Episode_33_-_EENT_1_-_The_Audio_PANCE_and_PANRE_Board_Review_Podcast.mp3Podcast: Download () | EmbedSubscribe: Apple Podcasts | Android | Email | Google Podcasts | Stitcher | RSS | PANCE and PANRE Podcast PlayerView all posts in this seriesThe Audio PANCE and PANRE Board Review Podcast Episode 1The Audio PANCE and PANRE Board Review Podcast Episode 3The Audio PANCE and PANRE Board Review Podcast Episode 5The Audio PANCE and PANRE Board Review Podcast Episode 7The Audio PANCE and PANRE Board Review Podcast Episode 9The Audio PANCE and PANRE Board Review Podcast Episode 11The Audio PANCE and PANRE Board Review Podcast Episode 13The Audio PANCE and PANRE Board Review Podcast Episode 15The Audio PANCE and PANRE Board Review Podcast Episode 17The Audio PANCE and PANRE Board Review Podcast Episode 19The Audio PANCE and PANRE Board Review Podcast Episode 21The Audio PANCE and PANRE Board Review Podcast Episode 23The Audio PANCE and PANRE Board Review Podca st Episode 25Cardiology 1: The Audio PANCE and PANRE Podcast Topic Specific Review Episode 27Pulmonology 1: The Audio PANCE and PANRE Podcast Topic Specific Review Episode 29Gastroenterology 1: The Audio PANCE and PANRE Podcast Topic Specific Review Episode 31EENT 1: The Audio PANCE and PANRE Board Review Podcast Topic Specific Review Episode 33Genitourinary 1: The Audio PANCE and PANRE Board Review Podcast Topic Specific Review Episode 35Musculoskeletal 1: The Audio PANCE and PANRE Board Review Podcast Topic Specific Review Episode 37Reproductive System 1: The Audio PANCE and PANRE Board Review Podcast Topic Specific Review Episode 39Episode 41: The Audio PANCE and PANRE Board Review PodcastEpisode 43: The Audio PANCE and PANRE Board Review PodcastMurmur Madness: The Audio PANCE and PANRE Episode 45Episode 47: The Audio PANCE and PANRE Board Review Podcast Comprehensive Audio QuizEpisode 49: The Audio PANCE and PANRE Board Review Podcast Comprehensive Audio QuizEpisode 51: The Au dio PANCE and PANRE Board Review Podcast Comprehensive Audio QuizEpisode 53: General Surgery End of Rotation Exam The Audio PANCE and PANRE PodcastEpisode 55: The Audio PANCE and PANRE Board Review PodcastEpisode 57: The Audio PANCE and PANRE Board Review PodcastEpisode 59: Emergency Medicine EOR The Audio PANCE and PANRE Board Review PodcastEpisode 61: The Audio PANCE and PANRE Board Review PodcastEpisode 63: The Audio PANCE and PANRE PA Board Review PodcastPodcast Episode 65: Hepatitis B Breakdown With Joe Gilboy PA-CPodcast Episode 67: Ten PANCE and PANRE Board Review Audio QuestionsPodcast Episode 69: Ten PANCE and PANRE Board Review Audio QuestionsPodcast Episode 71: Ten PANCE and PANRE Board Review Audio QuestionsPodcast Episode 73: Ten FREE PANCE and PANRE Audio Board Review QuestionsPodcast Episode 75: Ten FREE PANCE and PANRE Audio Board Review QuestionsPodcast Episode 77: The Audio PANCE and PANRE Board Review Podcast You may also like -Musculoskeletal 1: The Audio PANCE and PANRE Board Review Podcast Topic Specific Review Episode 37Welcome to episode 37of the FREE Audio PANCE and PANRE Physician Assistant Board Review Podcast. Join me as I continue tocover topic specific PANCE and PANRE review from the Academy course content following the NCCPA content []Genitourinary 1: The Audio PANCE and PANRE Board Review Podcast Topic Specific Review Episode 35Welcome to episode 35of the FREE Audio PANCE and PANRE Physician Assistant Board Review Podcast. Join me as I continue tocover topic specific PANCE and PANRE review from the Academy course content following the NCCPA content []Pulmonology 1: The Audio PANCE and PANRE Podcast Topic Specific Review Episode 29Welcome to episode 29of the FREE Audio PANCE and PANRE Physician Assistant Board Review Podcast. Over the next few episodes, I will be covering topic specific PANCE and PANRE review from the Academy course content following the NCCPA [] thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-57693597854487682712020-05-23T09:15:00.001-07:002020-05-23T09:15:04.644-07:00In Fifty Years Well All Be Chicks by Adam Carolla Free Essay Example, 750 words ï » ¿In Fifty Years We'll All Be Chicks by Adam Carolla In Fifty Years, We'll All Be Chicks, is a Carollaââ¬â¢s account regarding ââ¬Å"pussification of Americaâ⬠especially among the men who are losing their identity to the modernized state of living (Carolla 1). This encompasses, for illustration, the manner in which men have abandoned their identity and yielded to imitating numerous actions commonly characterizing women. Carolla points out some queer behaviors (judging from a manââ¬â¢s view) on how many men tend to spend many hours in front of a mirror trying to line up their beards (Carolla 27). This characterizes men who extend their keenness into intricate details regarding their looks. For instance, Carolla observed at one instance a man blowing nails, which were already colored. Hence, prompting him to conclude in Fifty Years coming man species will extinct, and all people will be chicks. Carolla starts first by expounding more regarding his upbringing, which catapulted him to where he is currently as a broadcaster (Carolla 2). He reveals that he is a product of separation and not a divorce, since, at the time, it entailed much paperwork and involvement of clerk. We will write a custom essay sample on In Fifty Years We'll All Be Chicks by Adam Carolla or any topic specifically for you Only $17.96 $11.86/page His early life encompassed struggles he made in acting, and becoming somebody who will have high esteem in society despite the negative advances he encountered. Carolla has written his account into chapters, which he offers diverse perspectives why in future the extinction of man is evident currently. His work incorporates comedy and funny manner of commending on various normal issues that make it exceedingly amusing to the readers. In Fifty Years, We'll All Be Chicks entails numerous issues, which Carolla observes eroding manââ¬â¢s real character to being a woman. For instance, he depicts the dissimilarity amid a ââ¬Å"Creepy Guyâ⬠and ââ¬Å"Cool Guyâ⬠in an office setting, where a receptionist enters and both commend on her dress code (Carolla 104). The Cool Guy gives her a commend which incorporates her figure and how the jeans fits, but the Creepy Guy just says ââ¬ËHey Kelly, nice jeansââ¬â¢, which makes the lady angry and reports t o the human resource (Carolla 104). This shows how men have inclined in worshiping the weaker gender to the extent of earning a slaps from them especially in that case. For instance, Kelly would have dealt with the Creepy Guy via a slap instead of forwarding the case to high authority. In his book, In Fifty Years Weââ¬â¢ll All Be Chicks, Carolla illustrates numerous incidences, which he feels are depriving the real man his status in this modernized society. This encompasses eroding his manliness and putting on femininity, hence degrading him to the state where in fifty years time he will be more of a woman than a man. For instance, ââ¬Å"Bathroom doos and donââ¬â¢tsâ⬠chapter expounds more about etiquette that must abound in the washrooms (Carolla 91). Carolla tackles numerous issues that surrounds humanity and concerns more to man, but currently seem to erode masculinity. Carollaââ¬â¢s view of the things according to his description seems as if standing by and wa tching each activity unwinding. His keen observance coupled with meticulous scrutiny, offers him an aggressive advantage to catch readersââ¬â¢ attention regarding simple, but essential life issues. In addition, he employs honesty to describe things the way they appear coupled with worldly wording. This comprises some words that are evident in the wording especially in conversations, which designates societal classes according to oneââ¬â¢s age. Carolla scrutinizes how men have turned and preferred women world using even preference in the media especially the choice of food and lifestyles proposed by media (Carolla 13). He also addresses the issue of political perspectives where citizens are unable in maintaining single-mindedness regarding the policies they want in life. People esteem what their leaders propose, which is according to their partiesââ¬â¢ cult, where they must exemplify total loyalty. He argues that the ââ¬Å"The only person who can change your life is you, â⬠and what amazes him, is how when election comes, the people whom he thought intelligent turn out to be bananas to his presence (Carolla 117). The book depicts the nature of Carolla, where at some occasions seems to be more conservative than expected. For instance, regarding the issue of Mexican, homosexual and teasing of women (Carolla 128). I tend to see his state being too humorous, since as a native of Los Angeles still is unable to understand and tolerate these groups. The mode of presenting his thoughts according to the chapter proves what he confesses that he had never read a book, thus his work resembling biblical format. Additionally, what are so humorous are his conclusions, which comprise individual sentiments regarding diverse issues especially homosexually. These conclusions and some of literature inside somehow possess some truth in them whereas others do not. Work Cited Carolla, Adam. In Fifty Years Weââ¬â¢ll All Be Chicks. New York: Crown Archetype, 2010. Print. thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-18422151841984562652020-05-18T19:24:00.001-07:002020-05-18T19:24:13.927-07:00The Colonization Of The New World - 1333 Words ââ¬Å"Be fruitful and increase in number; fill the earth and subdue it.â⬠, thatââ¬â¢s exactly how all the ethnic groups wanted to accomplish dealing with this discovery in this foreign land with farming and the dry land possession in many field spirituals. The colonizationââ¬â¢s in the New World was consistently complex to keep peace during those days from wars and competition for claiming the land of opportunities. Between the cultural differences, the Spanish, the Dutch, the French and the English, it was truly a sacrifice for each of them to fight and go for the same power, wealth, and national glory, but it could only belong to one. They eventually had to go in different paths and for each of them to conquer want they wanted to have because it did come with a price to pay. Everyone had their different reasons of why they came to the New World and when all of them arrived at different times the Spanish, Dutch, French, and the English had different ways to colonize the land of opportunities. The differences between the English and how they colonized their new world is that they would have their government involved too much from making decisions for wars, rules, and their colonies were mostly men. Specifically in Virginia the English only wanted single men, not families, not so much diversity when it came to families. However, the English colonized the Massachusetts Bay as well, which flourished with families. The English, saw coming to the new land as a precious gift, asShow MoreRelatedColonization of the New World3463 Words à |à 14 PagesColonization of the New World The discovery and colonization of the ââ¬Å"New Worldâ⬠was one of the most significant and influential events in the known history of mankind. It has shaped our present by changing the course of our past and is a time of such great significance that it would be all but impossible to understand today without at least some comprehension of the why s of yesterday. What was it that drove such a myriad of people to risk so much to tame the wild and vast lands we now knowRead MoreThe Colonization Of The New World1836 Words à |à 8 PagesThe colonization of the New World by the English began after Queen Elizabeth passed in 1603. This is when King James I signed a treaty with Spain ending decades of warfare after succeeding to the throne and needing new sources of income, the British decided to act on what they had previously ignored for a variety of reasons. The first colonies formed into two distinct regions, the Chesapeake and New England. Although both regions were colonize d by persons of English descent, they contrasted politicallyRead MoreThe Colonization Of The New World1068 Words à |à 5 PagesFrom 1689 to 1763, almost 200 years after Columbusââ¬â¢ discovery of the New World, several European nations fought to acquire their share of Americaââ¬â¢s wealth. The Spanish, leaders in the exploration of the New World, were the first to colonize the Americas. In 1494, two years after Columbusââ¬â¢ expeditions, the Treaty of Tordesillas was ratified by the Pope. This treaty split the New World between Portugal and Spain. By the mid 1500s, Spain had gained control of much of western South America, Central AmericaRead MoreThe Colonization Of The New World Essay2310 Words à |à 10 Pagesthat the new world, where these slaves were being sent to, had never before been colonized by the Europeans. This meant that only the native populations cultures were in place in both North America and South America, along with the Caribbean islands. As the Wester n European peoples colonized the territories, alongside the slaves that worked the plantations there, a new culture never before seen began to emerge. It was during this time that the diaspora of these African people created new prosperityRead MoreEuropean Colonization Of The New World1224 Words à |à 5 PagesEuropean colonization of the New World began during the European age of exploration and following the discovery of resources in the New World. The various motives of the Spanish, British, and French imperialists were reflected in the political, economic, and social changes that occurred in the areas each government claimed. These changes are very distinctive and led to drastic changes in their respective areas. Spanish conquistadors sought gold and treasure from uncharted lands. Backed by the infantileRead MoreEuropean Exploration And Colonization Of The New World1248 Words à |à 5 Pagespolitical, economic, and social reasons for European exploration and colonization of the New World Power was the main focus for the Europeans to explore and colonize the new world. The Europeans realized by possessing colonies in the new world, they would grow and have more power to challenge other nations. The Spanish became a competitor because they started to realize how valuable the new land could be to their country by obtaining new riches from the land. By discovering these riches, the country wouldRead MoreColonization Of The New World s Mission939 Words à |à 4 PagesColonization is the act of setting up a colony away from one s place of originâ⬠(Colonization, 2015) .The history of the colonization of Massachusetts and Georgia is very interesting both of these two colonies were founded under basically the same premises which were seeking a better life. However, there are some similarities and differences that are evident. The founders of the New Worldââ¬â¢s mission were freedom. However, their number reasoning was spiritual freedom. They were tired of the ChurchRead MoreSpanish And British Colonization Of The New World970 Words à |à 4 Pagescolonizing the new world relatively at the same time their colonization efforts weââ¬â¢re extremely different but had some overlapping similarities. The differences include the two nations different reasoning to explore the New World, their relationship with the Natives, and it types of governments that they attempted to set up. Although some of these differences might not seem as if they are very important, they helped one nation do you better than the other one when it came to colonization efforts. FirstRead MoreThe European Nations And The Colonization Of The New World898 Words à |à 4 PagesNations short after the discovery of the New World sought out to colonize it for befits of there own nations. The three European Nations most involved in the colonization of the New World was Spain, France and England but each for there own unique reasons. The Spanish, the French and the English desire for wealth, religious expansion, and political advantages motivated them to attempt to colonize the New World. Although they were all able to set foot on the New World some where able to colonize enablingRead MoreColonization Or Imperialism Is Done By Treaties Or Agreements?1652 Words à |à 7 Pages Colonization Lis Mendez AIU Online Abstract Prior to the modern or new era it was believed that conquers who conquered other lands had the right to take possession of that land, its riches, resources and even the people in order to achieve their own political agenda. Today the concept has changed, colonization or imperialism is done by treaties or agreements, they are acts in which governments negotiate with a less powerful country, they lead them to believe that their colonization will thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-22663078157237579632020-05-12T02:57:00.001-07:002020-05-12T02:57:03.249-07:00Great Quotations About College College quotations can address everything from life as a starving student to the value of an education. Below are some of the most on-the-spot, pithy, and overall great quotations about college. (For full citation information, please see details at the end of the article.) College Quotations A University should be a place of light, of liberty, and of learning. -- Benjamin Disraeli, speech, House of Commons, March 11, 1873 (Oxford)Men may be born free; they cannot be born otherwise, and it is the duty of the university to make the free wise. -- Adlai Stevenson (Esar)The true University of these days is a collection of books. -- Thomas Carlyle, On Heroes, Hero-Worship, and the Heroic (Oxford)Our colleges ought to have lit up in us a lasting relish for he better kind of man, a loss of appetite for mediocrities. -- William James, The Social Value of the College-Bred (Bartlett)A college education doesnt make fools; it merely develops them. (Esar)Universities incline wits to sophistry and affectation. -- Francis Bacon, Valerius Terminus of the Interpretation of Nature (Oxford)An education is a wonderful thing; no college should be without one. (Esar)College is a refuge from hasty judgment. -- Robert Frost, quote, July 9, 1961 (Oxford)My whaleship was my Yale College and my Har vard. -- Herman Melville, Moby Dick (Bartlett)The use of the university is to make young men as unlike their fathers as possible. -- Woodrow Wilson (Esar)A Harvard education consists of what you learn at Harvard while you are not studying. -- James B. Conant, Time (September 29, 1986) (Oxford)Dont join too many gangs. Join few if any. Join the United States and join the family --But not much in between unless a college. -- Robert Frost, Build Soil (Bartlett)Many a man spends the happiest years of his life as a freshman at college. (Esar)D ye think th colledges has much to do with th progress iv th wurruld? asked Mr. Hennesy. D ye think, said Mr. Dooley, tis th mill that makes th wather run? -- Finley Peter Dunne, On Wall Street (Bartlett)To live for a time close to great minds is the best kind of education. -- John Buchan, Memory Hold-the-Door (Oxford)Life isnt all beer and skittles, but beer and skittles, or something better of the same sort, must form a good part of every Englishm ans education. -- Thomas Hughes, Tom Browns Schooldays (Bartlett)Some students go to college to learn to think, but most go to learn what the professors think. (Esar)He who enters a university walks on hallowed ground. -- James Bryant Conant, Notes on the Harvard Tercentenary (Bartlett)Education begins when your father sends you to college, and is completed when you send your son there. (Esar) Sources: Bartlett, John. Bartletts Familiar Quotations, Fifteenth Edition. Little, Brown, Company. 1980. Esar, Evan. 20,000 Quips Quotes. Barnes Noble, Inc. 1995. The Oxford Essentials Quotations Dictionary, American Edition. Oxford University Press, Inc. 1998. thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-24540239626681799652020-05-06T21:06:00.001-07:002020-05-06T21:06:11.011-07:00Oman And The Middle East Stratum - 1183 Words Over the past thousand years, Oman has occupied a key strategic space in the Middle East stratum. With its vast mountain ranges, desert terrain, and steep cliffs along the coast, Oman over the years has proven to be very difficult to invade. This has allowed Oman to repel the majority of attacks from foreign militaries and maintain their sovereignty. The Southern and Eastern coastline of the country represents the key that makes Oman so important to the strength of the Middle East. Oman is a major piece to the peace in the Middle East. Oman lies in the southeast corner of the Arabian Peninsula right on the Tropic of Cancer latitude line (International, 2011). Yemen, Saudi Arabia, and the United Arab Emirates border Oman from the southeast, west, and the north. Oman also claims many islands in the Arabian Sea and in the Strait of Hormuz off Omanââ¬â¢s northern tip. Similar to its surrounding nations, Oman has a mountain range that spans the country. The Hajar mountain range begins at the north-west tip and extends down its western border to the southwest, near Yemen (International, 2011). The Omanis compare The Hajar to a human backbone, for it forms a great arc much like the human skeleton. The Interior of Oman is mostly sand dunes, rocks, and gravel, which is very similar to the entire Middle East region (International, 2011). Omanââ¬â¢s coastline stretches 1,700 km from North to South. Low hills and wastelands with little vegetation is what fill these coastlinesShow MoreRelatedStrategic Piece Of Middle East Peace1189 Words à |à 5 PagesStrategic Piece to Middle East Peace Over the past thousand years, Oman has occupied a key strategic space in the Middle East stratum. With its vast mountain ranges, desert terrain, and steep cliffs along the coast, Oman over the years has proven to be very difficult to invade. This has allowed Oman to repel the majority of attacks from foreign militaries and maintain their sovereignty. The Southern and Eastern coastline of the country represents the key that makes Oman so important to the strengthRead MoreMarket Analysis of Jeans Industry in Surat17928 Words à |à 72 Pagesthe organized Retail sector in India. The growth pattern in organized retailing and in the consumption made by the Indian population will follow a rising graph helping the newer businessmen to enter the India Retail Industry. In India the vast middle class and its almost untapped retail industry are the key attractive forces for global retail giants wanting to enter into newer markets, which in turn will help the India Retail Industry to grow faster. Indian retail is expected to grow 25 per cent thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-55738114257010250352020-05-06T11:44:00.001-07:002020-05-06T11:44:14.260-07:00Benefits of leadership Free Essays The Benefits of the Leadership Course Responsibility O A responsible person Is one who is able to act without guidance or supervision, because he or she Is accountable and answerable for his or her behavior. C) You will be prepared for both the risks and the opportunities that accompany new roles. C) Your responsibility will grow, giving you an edge on others O A person who does as promised deed can be considered as reliable. We will write a custom essay sample on Benefits of leadership or any similar topic only for you Order Now C) How does being responsible pay? C) A person who has a reputation of being responsible is trusted to do things on his or her own, without supervision. Leads to self esteem, promotions, Develops Leadership Qualities O Questions How do you handle yourself in unexpected or uncomfortable situations? An effective leader will adapt to new surroundings and situations adjust. O You can develop Important qualities Having these qualities Improves your self-esteem and Job situations Major qualities include open-mindedness, enthusiasm. Inconsistency, courage, and confidence C) You will be prepared to deal with real life situations Example is getting a job O Gain feedback on your existing strengths ââ¬â and weaknesses ââ¬â as a leader Service Opportunities O it makes you get involved O colleges see the amount of service hours O by volunteering and helping others, you get to learn and see more about your community C) colleges want to see you being more productive and caring to others and not just yourself. C) It gets you familiar with the environment of the working class and the business roll O questions do you volunteer at any organization? What does your organization do to help your community? Have you learned anything by doing this service? Develops Leadership Ability in Extracurricular Activities (D gives you ability to lead in your club/sportââ¬â¢s team C) gives you extra edge over other students/athletes C) enables you to hold a leadership position on a sportââ¬â¢s team In school or In a club (D gives you opportunity to hold office in student council How to cite Benefits of leadership, Essays thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-8215486935753049652020-05-06T04:37:00.001-07:002020-05-06T04:37:03.113-07:00Technology Audit & Technology Assessment Question: Describe about the Technology Audit Technology Assessment. Answer: Introduction Audi is one of the leading car manufacturers that produce high quality premium cars with modern designs. The company is currently operating in over 100 markets of the world. It has several manufacturing units in Germany, Belgium, Hungary, and China. 3D printing is an additive manufacturing technology in which objects are produced using layer by layer addition of small nano sized particles. This report would explore the concept of 3D printing, its applications, its limitations and industry scenario. Audi is one organization that has adopted 3D printing for printing its parts and thus, in the reflective section of this report, the case of Audi would be explored and a framework for technology adoption of 3D printing would be created for Audi as an automotive brand. This framework would be based on the understanding of the concept learned about technology management in the course curriculum. Article Summaries Additive Manufacturing: The effects of 3D printing The paper explored global opportunities for 3D printing considering consumers, SMEs, and large corporations. The technology is already used in crafts and animation by consumers, medical services, auto parts and toys manufacturing by SMEs and industrial RD by large corporations. Companies have also started to use it for apparels, food, bicycles, life science experiments, and power tools. Some applications are still being researched such as organ replacement and consumer electronics(KANDELA, 2015). In additive manufacturing very small components of the size of 100 nanometers are made and deposited to create an object. Initially, the technology was used only for mockups and prototyping but now its use is spread to production of finished parts as well as products. 3D printing can produce light weight materials at lower costs. Scientists today are exploring if it can be used to produce self-organizing materials that can change shape based on the changes in the environment. 3D printing is growing fast today and is expected to reach $5 billion sales by next year, 2017. Major industries using it include automotive, industrial, aerospace, and healthcare. 3D printing has many benefits as well as challenges that were described in detail in this paper such as the benefits of inexpensive single item prototyping, reduced lead times, and rapid innovation, and challenges of dependence on printer speed, limitations on materials, and high cost of production in large volumes. 3D printing adoption framework was presented in the paper that identified steps including establishing initiative, investing in the technology, creating a network, changing organization with respect to skills and abilities, and implementation of innovation(Halmes Pierreu, 2014). The Impact of 3D Printing on the Automotive Sector Factors like continues improvements in manufacturing processes, expiring patents, and newer processes of manufacturing such as 3D printing have created several opportunities for automotive organizations and newer consumer segments are emerging as a result. With the use of 3D printing, manufacturing parts and tools can be produced at lower costs. 3D printing has got much media attention and questions have been raised on its potential to replace traditional manufacturing processes. This report explored various companies cases to examine how 3D printing technologies like those provided by Stratsys and 3D systems are being used in automotive sectors(IHS, 2015). How will 3D printing make your company the strongest link in the value chain? 37% of German companies have already adopted 3D printing technology for improving their supply chains while 12% are planning to adopt. Traditional machines and materials are being replaced by that 3D printed. This has helped companies in two ways - produce lightweight or complex components that improve the quality of the product and allowing customization even in low volume production. Further, 3D printing makes a flexible and low cost production process for spare parts that can help companys turnaround their supply chains. However, there are still some barriers to its adoption such as high level of initial investment and technical limitations on size, color and material printing. Yet, because of its sustainability potential and cost effectiveness, companies have started to adopt it in large numbers. Operational models of companies using 3D printing as the manufacturing process can involve an acquisition of a facility, joint establishment, or use of existing 3D printing network of suppliers. The choice of operational model is dependent on value add by process, necessity for in-house production, cost of implementation, and so on. 3D printing can help a company at three levels: Supply chain operations that can be made more cost effective and efficient with reduction of transportation and inventories; product designing through new structures and use of customization; and company through addition of business models and value chain re-positioning(EY, 2016). The Current Status and Impact of 3D Printing - An Analysis of Six Case Studies The paper talks about some benefits of 3D printing such as reduced need of fixed assets, low cost production even in low volumes, and ability to easily produce complex shapes in parts. It also highlighted major applications of 3D printing such as consumer products, medical products, commercial hardware, and toys. The paper also discussed intellectual property implications of replacing traditional parts with 3D printed parts. AS per European Design Directive while producing a new part with 3D printing, it should have new design and must also have separate individual characteristics that do not match with existing produces manufactured using patented traditional manufacturing processes. The paper presented some case studies on different markets included automotive, domestic appliances, and customized goods. Automotive market case study covered 3DP parts, automotive aftermarket, additive manufacturing drivers, AM limitations, and data considerations. Domestic appliances use cases were described. It was found that Am presented many short-term opportunities in automotive production but parts produced cannot fully replicate traditionally produced parts. In domestic appliances production, 3D printing is still majorly used for DIY products and its use for production of spare parts is still in the nascent stage of adoption. The paper also highlighted the fact that consumers have started to act as designers with the use of 3D printing solutions like MakiLab, UCODO, and N-E-R-V-O-U-S system making way for many online production tools(Reeves Mendis, 2015). The 3D opportunity in the automotive industry 3D printing has changed the way companies design, develop, manufacture and distribute products. Additive manufacturing is majorly used by Original Equipment Manufacturers for rapid prototyping. OEMs in automotive sector are few due to high entry barriers but competition in suppliers is high as there are over $1.5 trillion suppliers of parts and accessories of automotive sector. Additive Manufacturing can become a game-changer when considering the competition between the manufacturers as it provide a source of innovation, can reduce overall costs of production, reduce lead times, and reduce complexity of supply chain. When considering the value provided by AM, there can be performance trade-offs like capital versus scale and capital versus scope. If a company uses less of capital and is still able to achieve the scale, it can affect the configuration of supply chain and if it can achieve a greater scope with it, the impact would be on product design(Wahlstrm Sahlstrm, 2016). While using AM, companies can take any of the four tactical paths from improving value delivery, transform supply chains, achieve innovation with performance improvement, or alter both supply chain and products. Most automotive companies are currently on the path 1 or stasis which involves only improvements in value delivery and no radical changes are made. In this path of adoption of 3D printing, companies use it for product design improvements, rapid prototyping, customizing tools, and reducing tooling costs. In future, companies are likely to adopt path III and IV with more complex designing, production cost reduction, improvement in market responsiveness, and creation of smaller supply chains. There are some key drivers to adoption of AM such as greater choice in material and their properties, reduced preprocessing, and improved quality of AM manufactured product. There are also certain challenges such as low volume production, limitations on production of large parts, shortage of talent, and concerns of intellectual property rights. Despite these challenges, AM has the potential to support automotive companies through improvement in performance and through innovation(Giffi, Gangula, Illinda, 2014). Framework A technology adoption and management framework may be used for describing the adopting of 3D printing technology by Audi manufacturing organization. Before going into the technology adoption by any organization, a world view may be used for understanding its current operations and their connection with the external environment and the industry. The World view creates boundaries of knowledge in any area of technology including micro environment which explores the organization, its customers and competitors, and macro environment explores industry trends, technology trends, and political trends. Using the model, Audi as a company and automotive industry can be exploring with respect to 3D printing as a potential technology to adopt for manufacturing. Automotive industry is moving towards the use of 3D printing for making small parts that can be used while assembling cars in production line. However, critical parts that go inside the car are not being produced using 3D printing. The automotive industry uses 3D printing mainly for two purposes - one, is to reduce cost of production and second, to bring innovation through flexibilities in part designs. For managing technology, a framework which links technological resources with the objectives of the company can be used in the following ways: Objectives of the company: The Company aims to introduce new models to the market and thus, is spending on building new production capacities and producing innovative automobiles. 3D printing adoption supports the objective as it would help company produce more innovative vehicles and produce them faster with 3D printed parts such that time to market is less and the company is able to achieve its strategic goal of introducing new vehicles and increasing its sales. Environment: The business environment of the company is affected by the fluctuations in currency and variations in the economic environment which can affect operations of the organization. In such a situation, if the cost f production can be reduced such that the margins of the company increase, it would be able to sustain in such fluctuations and still get decent profits. When using 3D printing is used, the cost of production can be reduced drastically which would help Audi company to sustain in the highly dynamic business environment(Audi, 2004). Technology adoption can be seen from technological and commercial perspectives which would the lenses used for exploring strategy, innovation capability and operational decisions of the organization. How each of these factors would be managed in the management of 3D printing technology by Audi is discussed below: Strategy: The Company aims to launch new vehicles which would bring more business value as the company would make more sales in the market. 3D printing would help company produce external parts that are different and innovative designs which would bring an opportunity for the company to come up with more variants and thus, make more products to sell in the market. Innovation: 3D printing can bring in innovation as it provides flexibility in production of parts with varied and complex designs. Moreover, the parts produced by 3D printing can be tailored to individual models of vehicles making the innovation work differently for different models. From the perspective commercial impact of such innovation, it can be observed that innovation would help company sell to wider segments and thus, make more business. Moreover, innovative designs can be priced higher from base models which would further increase the profit margins for the organization. Operations: The Company had already purchased its own 3D printing facility which it is using for the production of some parts of the automobile and in future the same can be used for production of more and more parts. This can be a huge cost at the time of acquisition of the technology but once that is done, it would save on the operational and production costs later on. Conclusions This report was prepared to understand how technology adoption works. A case of Audi was taken and the technology explored was 3D printing. The paper took 5 research reports that were explored to understand 3D printing, its applications, its limitations, adoption and more. A framework for adoption of 3D printing as a business model for Audi was presented. References Audi. (2004). Our Vision, Mission, Strategic Goals, and Objectives. USA department of Commerce. (2016). How will 3D printing make your company the strongest link in the value chain? ErnstYoung GmbH. Giffi, C. A., Gangula, B., Illinda, P. (2014). 3D opportunity in the automotive industry:Additive manufacturing hits the road. Deloitte University Press. Halmes, M., Pierreu, L. (2014). Additive Manufacturing: The effects of 3D printing. Deloitte. IHS. (2015). The Impact of 3D Printing on the Automotive Sector. IHS Technoology. KANDELA, A. R. (2015). IMPACT OF DISRUPTIVE TECHNOLOGY IN BUSINESSES. Jamshepur: XLRI. Reeves, P., Mendis, D. (2015). The Current Status and Impact of 3D Printing - An Analysis of Six Case Studies. CIPPM. Wahlstrm, T., Sahlstrm, J. (2016). Additive Manufacturing in Production. Lund University. thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-51746055356192492232020-05-01T08:38:00.001-07:002020-05-01T08:38:02.276-07:00Companies Need To Actively Follow Dynamic â⬠Myassignmenthelp.Com Question: Discuss About The Companies Need To Actively Follow Dynamic? Answer: Introduction Retailing has today reached a tipping point, no longer getting to avoid omnichannel shopping. The changing demographics and technologies have also permanently altered how consumers behave and the retailers have faced this in a completely unprecedented manner. Today, simply proactively managing store portfolios would not do companies need to actively follow a dynamic, advanced and data-centric outlook to build the operations store portfolio for ensuring continuing viability (Walsh 2016). Discussion E-commerce is growing, and the growth will continue. However, it does not imply that brick and mortar would die because of it, at least not in the near future. Brick and mortar retailers have knowledge and supply chain capabilities. What they lack is technological knowledge and understanding, which can be managed by organically by means of hiring people or by partaking in acquisitions (Agrawal 2017). Shoppers are always into wanting to touch, feel and experience the product they want to buy, before buying it. They might be using digital means for researching and narrowing down their choices, but when the matter comes to compensating and buying, they look forward to seeing it in real and making sure they are making the correct choice. The future of retail is situated at the juncture of brick and mortar and e-commerce. The two shopping experience forms must be seamlessly integrated and must complement each other. The main objective for each of these shopping experiences is the same - making the method of buying products for customers as stress-free and exciting as possible. Today, as the modern shoppers have gained admittance to new technologies and changed what they wish to buy, both e-commerce and brick and mortars companies have had to alter their approached and adapt (Popomaronis 2017). It is difficult to present to customers a convincing and sticky brand experience online, especially if the products on display are non-utility items similar to accessories, apparels and home goods. In this process, many businesses have already lost money online and still offline they have been highly profitable. This tendency is getting compelled by a wish to exploit the growth in the experience economy buyers are selecting to purchase experience over products. E-commerce might be expedient, but consumers look for surprise and extemporaneity while shopping, which is only available in a brick and mortar environment. Among convenience and smart shopping, there exists a positive tension, which exist with the knowledge that there would be a pragmatic element too. At the end of the day, it is all about the comprehension of the different needs and preferences of the consumers and meeting them by means of exciting and quirky ways, not only with the help of online of offline experience, but with the connection that exists between them all (Shearman 2016). Conclusion Online shopping is trending upward and some sections of retail feel the influence more than others, like apparel and consumer goods. Online sales still today do not alone represent the whole of retail spending the need and demand for physical stores still exist and its role inside the omnichannel world still remains critical. References Agrawal, A. 2017.Does eCommerce Success Mean Physical Stores Will Disappear in the Future?. [online] HuffPost. Available at: https://www.huffingtonpost.com/aj-agrawal/does-ecommerce-success-me_b_8904146.html [Accessed 10 Sep. 2017]. Popomaronis, T. 2017.Survival In Today's Retail Environment Means Merging Physical And Digital. [online] Forbes.com. Available at: https://www.forbes.com/sites/tompopomaronis/2017/06/30/survival-in-todays-retail-management-means-merging-physical-and-digital/#45843ba16e9c [Accessed 10 Sep. 2017]. Shearman, S. 2016.Back to bricks and mortar: how e-commerce has embraced the real world. [online] the Guardian. Available at: https://www.theguardian.com/media-network/2016/jul/07/bricks-and-mortar-ecommerce-retail-digital [Accessed 10 Sep. 2017]. Walsh, M. 2016.The future of e-commerce: bricks and mortar. [online] the Guardian. Available at: https://www.theguardian.com/business/2016/jan/30/future-of-e-commerce-bricks-and-mortar [Accessed 10 Sep. 2017]. thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-21281039755818883382020-04-10T22:04:00.001-07:002020-04-10T22:04:04.138-07:00IB History PaperIB History PaperIt is time to explore IB history and sample essays. You've spent months or even years studying, grading and preparing for the IB exams. Now is the time to take the next step by preparing for a challenging, yet rewarding and all-encompassing IB course.A course like the IB is designed to give you an advanced level of your degree. All students who enter IB, must complete the IB Level I course in order to be awarded the degree. You've earned your credit hours through working hard and choosing wisely.Completed IB paper contains different levels of difficulty. Some students have higher expectations and expect the level of the paper to be high. This kind of students should prepare a detailed essay that is easier than the one for the others. Of course, this does not mean that the higher student has the right to lower the standards.Some students are not comfortable with writing essays and prefer to work on self-tests instead. These types of students can do this through the hel p of a variety of online resources. These materials are meant to be used for studying, which is often a time consuming activity and makes them less useful for a standardized test.It is important to remember that the IB is not just a standard test. It also includes an essay, a detailed test, interviews and a lecture that should be thoroughly understood before getting the results.The IB course of study includes the type of essay that you will have to write. The essay will most likely be based on a research project, your studies, or an actual experience. The reason for this is that the IB also expects students to speak up in person, answer questions, and give a presentation as well.IB history paper contains a lot of preparation. Make sure that you have read and understand the IB guidebook carefully and practice some if you can. thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-43993629880331460772020-03-21T19:48:00.001-07:002020-03-21T19:48:03.601-07:00The Decline of the Dutch Republic in 1650 to 1713 Essay ExampleThe Decline of the Dutch Republic in 1650 to 1713 Paper The Decline of the Dutch Republic in 1650 to 1713 The Dutch Republic, in 1650, was an intimidating power; the Dutch Republic boasted dominant commercial, financial, and naval power. The Dutch Republic accredited much of their power to their most power province, Holland. Holland, dominated by Amsterdam, was a leading trading center in Europe. Although The Dutch Republic enjoyed a domineering power before 1650, the Peace of Utrecht brought about the decline of the Dutch Republic, due to a series of European wars, internal disunity and conflict, and a loss of trade dominance and economic prosperity. The Dutch Republic was the center of multiple European wars, that contributed to its decline. The Treaty of Dover, of 1670, promised a war on the Dutch Republic, in which France and England would join forces to bring about the downfall of the Dutch Republic. In a Resolution of the Amsterdam City Council, in 1671, it was noted that the monarchs waging war against the Dutch Republic were solely interested in taking parts of the Dutch Republic for their own kingdoms. In a letter from the Dutch ambassador to England in 1672, Konrad Van Beuningen reported that the onslaught of war from France and England could deteriorate the commerce of the Dutch Republic. The citizens of the Dutch Republic suffered socially from the wars that the Dutch Republic fought. We will write a custom essay sample on The Decline of the Dutch Republic in 1650 to 1713 specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on The Decline of the Dutch Republic in 1650 to 1713 specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on The Decline of the Dutch Republic in 1650 to 1713 specifically for you FOR ONLY $16.38 $13.9/page Hire Writer In a letter about the Dutch reaction to losses suffered in the war. An English resident in the Dutch Republic notes that the enormous draw of males to fight the war is taking a toll on the citizens of the Dutch Republic. The losses suffered from the wars with France and England brought on the deterioration of the Dutch Republic, through their economic and internal struggles. The Dutch Republics decline was, in part, caused by the economic declination; which was catalyzed by the wars France and England waged on the Dutch Republic. Although Sir George Downing, the English ambassador to the Dutch Republic in 1664, may have been exaggerating the shattered state of the Dutch Republic, in a letter to the English government, Downing described the Dutch Republic as being shattered and a divided thing that depends on the previously wealthy province of Holland. The national debt of the Dutch Republic in 1688 increased immensely, so that in 1713 the national debt of the Dutch Republic more than tripled. The national debt in 1688 was a result of the war against England and France and the Dutch Republic never recovered due to the wars the Dutch were forced to fight against France. Although the debt was so immense, that every province of the Dutch Republic felt it, the few wealthy citizens of Amsterdam remained virtually untouched and stayed the wealthiest citizens of the Dutch Republic. The heavy class distinctions of the Dutch Republic during 1650 to 1713 contributed to the growing unease within the provinces. The disunity and conflict within the Dutch Republic contributed to its overall decline as a major power during 1650 to 1713. In a government report of the Dutch Republic in 1683 reports on the fact that the different provinces of the Dutch Republic cannot agree on how to oppose the attacks of Louis XIV in the war against France and England. Although the government report on the Dutch Republic seems unbiased and is therefore to be trusted, the political pamphlet published in Amsterdam, 1683 is to be regarded as slightly exaggerated. The pamphlet describes the wealth citizens of Amsterdam with some bitterness. The pamphlet is sympathetic to the struggling citizens of the Dutch provinces and describes them as the only source of wealth in the Dutch Republic. The political pamphlet illustrates the disunion within the Dutch Republic as a result of economic hardships brought about by the wars the provinces participate in; the very wars that affected the once great trade power that the Dutch Republic was. The decline of the Dutch Republic was caused by the economic hardships prompted by the wars the Dutch Republic was forced to defend itself against. The trade competition caused by the English East India Company was reported to be the real cause of the war between England and the Dutch Republic by Marquis de Pomponne, the French ambassador to the Dutch Republic, in a report to the French government in the early 1680s. In the map of the Dutch Republic and Rival States in the Late Seventeenth Century, the map shows the numerous naval battles the Dutch Republic was fighting against England. As a result of the naval battles fought, the Dutch Republic suffered great losses from their trading. There was an estimated 2,000 to 2,700 Dutch shops seized by the English during the Three Anglo-Dutch Wars in 1652 to 1674. To make up for the lost revenues that resulted from a massive number of Dutch trading ships seized, the Dutch Republic planted heavy taxes on merchants. In an anonymous pamphlet published in the province of Holland in 1669 an unnamed citizen of the Dutch Republic notes that the heavy taxes set of the merchants are a burdensome addition to the losses they are already suffering from the naval battles the Dutch Republic is involved in. Although the writer of the pamphlet is clearly biased towards the merchants, the pamphlet is to be regarded as true because the writer, most likely a merchant, experienced the burden of the taxes first hand. The wars waged against England did not solve the trade problem as illustrated in a letter to the directors of the Dutch East India Company in 1705 from a Dutch colonial administrator. The letter reports that the East Indian trade is not earning any profits because of the competition with other countries. The Dutch Republic was previously an intimidating and dominating power in Europe. Its decline was caused mainly by the many wars it was forced to defend itself against. The wars the Dutch Republic fought caused great economic losses. The wars touched the Dutch Republics trading ships and caused further disunion within the provinces. The decline of the Dutch Republic was caused by a series of European wars, internal conflict, and a loss of trade dominance and economic abundance. thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-71033997743490519742020-03-05T10:14:00.001-08:002020-03-05T10:14:02.848-08:00Track Your Time and Boost Your Bottom LineTrack Your Time and Boost Your Bottom Line Do you keep track of how long it takes you to finish each writing project? Doing so will not only show you how much you earn per hour but will provide other great side benefits as well. For most of my freelancing career, Ive resisted tracking my writing time. I worried that it would affect the quality of my writing and, perhaps more importantly, that Id find out I would be better off flipping burgers. Thankfully, I discovered otherwise. Being aware that the clock is ticking, forces me to jump straight into the story instead of trying to find the perfect opening. Its also helping me stay focused on the writing, which means that I get more writing done in a shorter period of time. Im also motivated to stay on track so I can stay within a certain income range. When I start slowing down, I know its time to stop for a break. Theres no point in forcing myself to keep going because thats when the quality takes a dramatic nosedive. What surprised me the most was that this process has led me to look at time differently. Since I have two other careers, my writing sessions are often limited. In the past Id look at the clock and think, Whats the point. I only have half an hour. I felt it was barely long enough to get warmed up. Now I see those same thirty minutes and ask myself a critical question: What part of my story can I work on? In this way, Im able to fix a weak beginning, or an awkward ending, and oftentimes both. Additionally, Im better at not letting interruptions stop me, especially when Im in the flow. A favorite response of mine now is: Can it wait? I just need a few more minutes. Tracking your writing time will also help you determine how long you might need to finish a project requested Keeping track of your writing time is as simple as using a timer or jotting down the time when you start and end each writing session. Then transfer your total into a four-column spreadsheet with headings for: Title, Writing Time, Date, and Notes (optional). Once your story is completed, add your daily totals and voil! When you sell your story, youll know exactly how much you made per hour. And how much did I make with this article? I wrote in short bursts totaling about two hours, thus netting me $25 per hour. Not bad for someone whos never mastered the fine art of burger flipping! Although these numbers might not make me rich overnight, theyre a great starting point for helping me set goals that will increase my bottom line down the road while improving my efficiency and productivity. thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-66158020539628215572020-02-18T01:40:00.001-08:002020-02-18T01:40:02.533-08:00Human resources organization Assignment Example | Topics and Well Written Essays - 250 wordsHuman resources organization - Assignment Example I will set the goal of group deadlines for returning feedback and specific responsibilities and deadlines for each training lesson amongst the group members. They will be assessed on their current standing especially Susan and Hari for their laid-back attitude and late submission of work and how the other members cover up for them. This obstacle will be provided with options like formulating a time table or increasing work hours to avoid further delays or delegating and splitting the work into smaller easily attainable tasks. The best option will be implemented. Then the outcome/progress must be reviewed against objectives and analysis of the trainees; if unsuccessful then the strategy must be revised and trainers will be threatened of job security. If it works then it is an ongoing process. Setting and monitoring management strategies is never a static operation. thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-90264428668137780902020-02-03T15:09:00.001-08:002020-02-03T15:09:01.958-08:00The Role of Older Australians in Family Life AssignmentThe Role of Older Australians in Family Life - Assignment Example Contrary to other countries which are giving little importance or no importance at all to older people, Australia recognizes the essential role that older people assume in the society. They specifically believe that older Australians play an active and significant role in family life. This recognition serves as a proof that Australians are indeed family-oriented. As such, for the purpose of this essay, the older Australianââ¬â¢s family life, living arrangements and inter-generational role shall be discussed. Also, the change of their roles and activities beyond eighty years of age shall be analyzed. Generally, when one reaches the old age, he or she is somehow considered as irrelevant to the economic growth of a community. One may base this argument on the fact that old people often retire from work and are eventually left at home. This consequence is viewed by some as disadvantageous to oneââ¬â¢s family as well as to the government. The reason of which primarily revolves around the idea of ââ¬Å"financial cost.â⬠On the part of the family concerned, the presence of old people at home means ââ¬Å"additional dependents.â⬠With regard to the governmentââ¬â¢s side, an increase of the aging population which is higher than the rate of those newly born means lesser workforce and more funding for services like healthcare and medicine. In connection, Australia is observed to have been experiencing a problem with ââ¬Å"aging populationâ⬠(De Vaus, Gray & Stanton, 2003). For older Australians (aging sixty-five years and older), family life consists of two important matters, living arrangement, and inter-generational role.à thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-44107289226297188602020-01-26T11:32:00.001-08:002020-01-26T11:32:03.398-08:00Genetic Diversity and QoI Fungicide ResistanceGenetic Diversity and QoI Fungicide Resistance Study of genetic diversity and QoI fungicide resistance in frogeye leaf spot (Cercospora sojina) from Tennessee Introduction Frogeye leaf spot (FLS) of soybean (Glycine max Merr.), caused by the fungal pathogen C. sojina Hara, was first identified in Japan in 1915 and South Carolina, the United States in 1924 (Lehman 1928; Phillips 1999). FLS is an important foliar disease of soybean although symptoms can appear on stems, pods, and seeds. There has been no report of the alternative host in other crops or weeds (Mian et al. 2008). Initial symptom appears as small, light brown circular spot which is later surrounded by darkish brown to reddish circle. (Dashiell and Akem 1991). As the leaves are covered with 50% lesions, leaves start to blight wither and finally falls prematurely. On the lower surface of leaves, the central spot of lesions is somewhat grayish because of conidia produced on conidiophores. Conidia are a primary and secondary source of inoculum and are produced in infected leaves, stems, and pods. Warm temperature and frequent rainfall are suitable factors for severe disease, and fully expanded leaves are more resistant with small lesions as compared to younger leaves (Phillips 1999). The United States is the leading producer of soybean in the world. According to the food and agriculture organization (FAO), the US produced 108 million metric tons of soybeans, second only to corn in 2014 (http://faostat3.fao.org/). FLS is an important disease in most of the soybean growing countries in the world and the main factors hindering the yield includes a reduction in photosynthetic area and premature defoliation of leaves (Mian et al. 2008; Wrather et al. 2010). In the US, FLS is significantly present in Southern warm and humid regions (Mian et al. 2008; Yang et al. 2001). Now, C. sojina is also important to Northern states as the disease was reported in Iowa in 1999, Wisconsin in 2000 (Mengistu et al. 2002) and Ohio in 2006 (Cruz and Dorrance 2009). The damage caused by FLS depends on soybean cultivars and locations, and yield loss has been reported from 10% to more than 60% (Dashiell and Akem 1991; Hartwig and Edwards Jr 1990; Laviolette et al. 1970; Mian et al. 1998). FLS is a polycyclic disease and the disease remains active throughout the growing season (Kim et al. 2013; Laviolette et al. 1970). Dispersal of conidia to some distance is favored by the wind and water splashes (Laviolette et al. 1970). Mycelium of C. sojina can overwinter and a report suggests potential survival of the pathogen in the plant debris for two years (Zhang and Bradley 2014). There are several FLS control methods including cultural practices, use of fungicides and genetic resistance. Primarily, genetic resistance is a most effective measure to control FLS. Till now, three resistant genes Rcs (Resistant to C. sojina), have been deployed: Rcs1 (Athow and Probst 1952), Rcs2 (Athow et al. 1962) and Rcs3 (Phillips and Boerma 1982). The Rcs3 gene confers resistant against race 5 and all known races of C. sojina present in the USA. (Mengistu et al. 2012; Phillips and Boerma 1982). Similarly, crop rotation for two years has been suggested to skip viable inoculum and prevent dise ase severity in the field (Grau et al. 2004; Zhang and Bradley 2014). Further, use of pathogen-free seeds and necessary application of fungicides before flowering to early pod stage have been practiced to decrease disease severity (Grau et al. 2004). Meanwhile, because of change in the pathogen, it has been proven that resistant gene can confer resistance for a certain period and there can be selection against QoI fungicides too (Athow and Probst 1952; Athow et al. 1962; Zeng et al. 2015). There has already been a report of field isolates resistant to QoI fungicides in Tennessee (Zhang et al. 2012). Control measures like use of fungicides and planting of resistant cultivars force pathogens to select against selection pressure. Studies of C. sojina using several approaches indicate diversity among isolates. Because of the lack of universally accepted soybean differentials, its hard to characterize and compare C. sojina isolates. Grau et. al. (2004) have reported 12 races of C. sojina in the US, 22 races in Brazil and 14 races in China. A new set of 12 soybean differentials and 11 races have been proposed based on the reaction of isolates collected from the USA, Brazil, and China (Mian et al. 2008). However, the reaction of 50 isolates from Ohio on the same 12 soybean differentials produced 20 different races (Cruz and Dorrance 2009). There has been a handful of research to characterize C. sojina based on molecular markers. One study includes AFLP based assessment of 62 isolates from Brazil, China, Nigeria and the United States, which showed a significant amount of genetic diversity among isolates, although genotypes did not cluster based on origin. (Bradley et al. 2012). Recently, a study of 132 isolates fr om Arkansas with simple sequence repeat (SSR) has shown the chances of sexual reproduction and high genetic diversity in C. sojina (Kim et al. 2013). The main objectives of this study were to access: genetic diversity by developing and using novel SNP markers and distribution of QoI resistant and sensitive isolates from Jackson and Milan, TN. Sample collection, Single-lesion Isolation, and DNA extraction In 2015, soybean leaves exhibiting typical symptoms of infection with FLS were collected from research plots at two locations in Tennessee (Milan and Jackson). In total, 437 isolates, 203 from Jackson and 234 from Milan, were collected from eight fungicides treated and non-treated Maturity group III soybean cultivars (Table 1). Cultivars were planted in 4 rows (30-inch row spacing), 30 ft long plots in a randomized complete block design with four replications. Plots were split, two rows were not treated, and two rows were treated at R3 growth stage (beginning pod) with Quadris Top SB at 8 fl oz/a (Azoxystrobin and Difenoconazole, Syngenta Corp., Basel, Switzerland). A single isolate of C. sojina was obtained from a single lesion from each leaf. Sporulation was induced by incubating leaves in a plastic bag with moist towels at room temperature. Spores were harvested with a flame-sterilized needle using a dissecting microscope and 8-10 spores transferred to RA-V8 agar media (rifampicin 25 ppm, ampicillin 100 ppm, 160 mL unfiltered V8 juice, 3 gm calcium carbonate and 840 mL water). Observations were made daily and contaminated sectors removed. After seven days, single-lesion isolates of C. sojina were transferred to a new V8 agar media. In addition, a set of 40 isolates from 10 different states, collected before 2015, were included in this study (Table 2). Table 1. Soybean cultivars and number of Cercospora sojina isolates recovered from treated and non-treated cultivars. Cultivar ID Cultivars Jackson Milan Total Treated Non-treated Treated Non-treated C1 VAR Armor 37-R33 RR2 17 11 21 4 53 C2 VAR Asgrow AG3832 GENRR2Y 7 15 20 14 56 C3 VAR Becks 393R4 0 0 0 3 3 C4 VAR Croplan R2C 3984 19 13 11 14 57 C5 VAR Mycogen 5N393R2 RR2 g 12 20 17 28 77 C6 VAR Terral REV 39A35 10 15 13 16 54 C7 VAR USG 73P93R 22 6 13 21 62 C8 VAR Warren Seed 3780 R2Y It 14 22 13 26 75 Table 2. Number of Cercospora sojina isolates collected from Jackson (JTN) and Milan (MTN), Tennessee in 2015 and historical isolates from various states in previous years. Location No. of Samples Year JTN 203 2015 MTN 234 2015 AL 5 2006 AR 5 2006 FL 1 2006 GA 4 2006 IA 1 2006 IL 2 2006/09 LA 1 2006 MS 6 2006 SC 2 2006/2009 TN 12 2007 WI 1 2006 Note: JTN (Jackson) and MTN (Milan) collection in 2015 in Tennessee. TN is a historical collection. For DNA extraction, the single-lesion isolates were grown in 24-well deep well plates (Fisher Scientific) with 1 mL RA-V8 liquid broth (same as above, minus the agar) per well. DNA was extracted as described by Lamour and Finley (2006). Briefly, this includes harvesting mycelium from the broth cultures into a 96-well 2 mL deep well plate pre-loaded with 3-5 sterilized 3 mm glass beads. The plates are freeze dried and the dried mycelium powdered using a Mixer-Mill bead beating device (Qiagen). The powdered mycelium was then lysed and a standard glass fiber spin-column DNA extraction completed. The resulting genomic DNA was visualized on a 1% gel and quantified using a Qubit device. SNP marker discovery and targeted-sequencing based genotyping Whole genome sequencing was accomplished for three FLS isolates from a historical collection originally compiled by Dr. Dan Philips, UGA: FLS11 (CS10117) recovered from Milan, Tennessee in 2010, FLS19 (TN10) from the Georgia Experiment Station, and FLS21 (TN85) which was recovered from Mississippi. Genomic DNA was extracted from freeze-dried and powdered mycelium using a standard phenol-chloroform approach and the resulting DNA was submitted to the Beijing Genomics Institute in China for 2100 paired-end sequencing on an Illumina HiSeq2000 device. De novo assembly, read mapping and SNP discovery was accomplished with CLC Genomics Workbench 7 (Qiagen). As there was no public reference genome available at the time, FLS21 was de novo assembled using the default settings in CLC and the resulting contigs used as a reference genome. All open reading frames (ORFs) longer than 300 amino acids were predicted using CLC and annotated onto the FLS21 contigs. The raw reads from FLS11 and FLS19 wer e then mapped to the draft reference (separately), and putative single nucleotide variants (SNVs) identified at sites with at least 20X coverage and an alternate allele frequency greater than 90%. A subset of the SNVs was chosen from the largest contigs for further genotyping using a targeted sequencing approach. Custom Perl scripts were used to extract the flanking sequences for the panel of SNPs and primers were designed using BatchPrimer3 v1.0 (http://probes.pw.usda.gov/batchprimer3/) to amplify targets between 80 and 120bp in length. Primers for 50 SNPs including mitochondrial QoI resistant locus are summarized in Table 3. Primer sequences and genomic DNA were sent to Floodlight Genomics (Knoxville, TN) for processing as part of a non-profit Educational and Research Outreach Program (EROP) that provides targeted-sequencing services at cost for academic researchers. Floodlight Genomics uses an optimized Hi-Plex approach to amplify targets in multiplex PCR reactions and then sequences the resulting sample-specific amplicons on either an Illumina or Ion NGS device. Resulting sample-specific sequences were mapped to the reference contigs and genotypes assigned for loci with at least 6X coverage. QoI resistant locus genotyping A single nucleotide polymorphism (G/C) in the Cytochrome b gene of the C. sojina mitochondrial genome has been shown to confer resistance to QoI fungicides. A custom TaqMan SNP genotyping assay will be designed using the online design tools from Applied Biosystems (Thermo Scientific) and include the forward primer GGGTTATGTTTTACCTTACGGACAAATG and reverse primer GTCCTACTCATGGTATTGCACTCA and two probes to discriminate resistant and sensitive isolates: ACTGTGGCAGCTCATAA with VIC for the C resistance allele and ACTGTGGCACCTCATAA with FAM for the G sensitive allele (Zeng et al. 2015). Quantitative PCR (qPCR) will be accomplished based on manufacturer instruction using the QuantStudio 6 Flex Real-time PCR System (Thermo Fisher Scientific Inc.). Mating types determination A previously described multiplex PCR assay will be used to assign mating type (MAT1-1-1 or MAT1-2) to a subset of the isolates that had unique multi-locus SNP genotypes (Kim et al. 2013). The MAT1-1-1 locus will be amplified with CsMat1f (5 TGAGGACATGGCCACCCAAATA) and CsMat1r (5 AAGAGCCCTGTCAAGTGTCAGT) and the Mat1-2 locus will be amplified with CsMat2f (5 TGTTGTAGAGCTCGTTGTTCGCA) and CsMat2r (5 TCAGACCTTATGAGCTTGAAAGTGCT) primers (Kim et al. 2013). The assay will be included with the ITS5 (5 GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5 TCCTCCGCTTATTGATATGC ) primers as an internal control to amplify the internal transcribed spacer (ITS) region (White et al. 1990). The resulting PCR products will be visualized under UV light on 2% agarose gel stained with GelRed (Phenix Research Products) and scored based on fragment size of MAT1-1-1 (405 bp) and Mat1-2 (358 bp). Data Analysis SNP loci for each sample will be combined to form a multi-locus SNP genotypes and samples with identical genotype (clonal lineages) will be clone corrected. To assess population structure among the two locations (and in relation to the historical isolates), Bayesian clustering will be accomplished using Structure 2.3.4 (Pritchard et al. 2000). Structure Harvester (Earl 2012) will be used to find the most probable value of K from the results obtained from Structure analysis. Principle coordinate analysis, AMOVA, Nei pairwise genetic distance, Nei pairwise genetic identity and genetic indices will be analyzed with GENALEX (Peakall and Smouse 2006). Phylogenetic clustering of the unique genotypes will be accomplished using Mega 6.06 (Tamura et al. 2013). Minimum spanning networks (Bandelt et al. 1999) will be constructed with PopART (http://popart.otago.ac.nz/). Expected Results Novel SNP markers will be developed and assayed in C. sojina isolates. Population study will help to determine if the isolates from two locations are sub-grouped. The genetic study will also accesses genetic diversity present within and among populations. Molecular identification of mutated cytochrome b site will help to determine the distribution of resistant isolates and contribute to compare resistant isolates in fields between two different time periods. Study of two different mating types in population will help to predict sexual reproduction. References Athow K and Probst AH. 1952. The inheritance of resistance to frog-eye leaf spot of Soybeans. Phytopathology 42(12):660-662 pp. Athow KL, Probst AH, Kurtzman CP and Laviolette FA. 1962. A newly identified physiological race of Cercospora sojina on soybean. Phytopathology 52(7):712-714 pp. Bandelt H-J, Forster P and Rà ¶hl A. 1999. Median-joining networks for inferring intraspecific phylogenies. Molecular biology and evolution 16(1):37-48. Bradley C, Wood A, Zhang G, Murray J, Phillips D and Ming R. 2012. Genetic diversity of Cercospora sojina revealed by amplified fragment length polymorphism markers. Canadian Journal of Plant Pathology 34(3):410-416. Cruz C and Dorrance A. 2009. Characterization and survival of Cercospora sojina in Ohio. Plant Health Progress doi 10. Dashiell K and Akem C. 1991. Yield losses in soybeans from frogeye leaf spot caused by Cercospora sojina. Crop Protection 10(6):465-468. Earl DA. 2012. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation genetics resources 4(2):359-361. Grau CR, Dorrance AE, Bond J and Russin JS. 2004. Fungal diseases. Soybeans: Improvement, production, and uses(soybeansimprove):679-763. Hartwig E and Edwards Jr C. 1990. The uniform soybean tests, southern region, 1989. USDA Mimeographed Rep. US Gov. Print. Office, Washington, DC. Kim H, Newell AD, Cota-Sieckmeyer RG, Rupe JC, Fakhoury AM and Bluhm BH. 2013. Mating-type distribution and genetic diversity of Cercospora sojina populations on soybean from Arkansas: Evidence for potential sexual reproduction. Phytopathology 103(10):1045-1051. Laviolette F, Athow K, Probst A, Wilcox J and Abney T. 1970. Effect of bacterial pustule and frogeye leafspot on yield of Clark soybean. Crop science 10(4):418-419. Lehman S. 1928. Frog-eye leaf spot of Soy Bean caused by Cerco-spora diazu Miara. Journal of Agricultural Research 36(9):811-833. Mengistu A, Bond J, Mian R, Nelson R, Shannon G and Wrather A. 2012. Resistance to Frogeye Leaf Spot in selected soybean accessions in MG I through MG VI. Plant Health Progress 10. Mengistu A, Kurtzweil NC and Grau CR. 2002. First report of Frogeye Leaf Spot (Cercospora sojina) in Wisconsin. Plant Disease 86(11):1272-1272. Mian M, Boerma H, Phillips D, Kenty M, Shannon G, Shipe E, Blount AS and Weaver D. 1998. Performance of frogeye leaf spot-resistant and-susceptible near-isolines of soybean. Plant disease 82(9):1017-1021. Mian M, Missaoui A, Walker D, Phillips D and Boerma H. 2008. Frogeye Leaf Spot of Soybean: A review and proposed race designations for isolates of Hara. Crop science 48(1):14-24. Peakall R and Smouse PE. 2006. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular ecology notes 6(1):288-295. Phillips D. 1999. Frogeye leaf spot. Compendium of soybean diseases, 4th ed. American Phytopathological Society Press, St. Paul, MN:20-21. Phillips D and Boerma H. 1982. Two genes for resistance to race 5 of Cercospora sojina in soybeans. Phytopathology 72(7):764-766. Pritchard JK, Stephens M and Donnelly P. 2000. Inference of population structure using multilocus genotype data. Genetics 155(2):945-959. Tamura K, Stecher G, Peterson D, Filipski A and Kumar S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular biology and evolution:mst197. White TJ, Bruns T, Lee S and Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 18(1):315-322. Wrather A, Shannon G, Balardin R, Carregal L, Escobar R, Gupta G, Ma Z, Morel W, Ploper D and Tenuta A. 2010. Effect of diseases on soybean yield in the top eight producing countries in 2006. Plant Health Progress doi 10:2008-2013. Yang X, Uphoff M and Sanogo S. 2001. Outbreaks of soybean frogeye leaf spot in Iowa. Plant Disease 85(4):443-443. Zeng F, Arnao E, Zhang G, Olaya G, Wullschleger J, Sierotzki H, Ming R, Bluhm B, Bond J and Fakhoury A. 2015. Characterization of quinone outside inhibitor fungicide resistance in Cercospora sojina and development of diagnostic tools for its identification. Plant Disease 99(4):544-550. Zhang G and Bradley CA. 2014. Survival of Cercospora sojina on soybean leaf debris in Illinois. Plant Health Prog 10. Zhang G, Newman M and Bradley C. 2012. First report of the soybean frogeye leaf spot fungus (Cercospora sojina) resistant to quinone outside inhibitor fungicides in North America. Plant Disease 96(5):767-767. thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-1809667676803747542020-01-18T07:55:00.001-08:002020-01-18T07:55:02.942-08:00William Shakespeare BiographyApril 23 of 1564 the beginning to the path of great literature and performance, the birth of William Shakespeare, whose creations have affected everyone for generations. |He was born and raised in Stratford-upon-Avon. William was the third child out of eight from John and Mary Shakespeare. The names of the other seven children are Joan, Margaret, Gilbert, Joan, Ann, Richard and Edmund. Williamâ⬠s grandfather, Richard Shakespeare was a whittawer and a dealer in agricultural commodities. Richard died 52 days after the birth of William. William attended the Stratford Grammar School. Even though the record-of- attendance have been lost it is no doubt that he truly attended the school, since the school was built and maintained expressly for the purpose of education the sons of prominent citizens. Because William attended church, the other obvious education is the exposer to either the Geneva Bible or the Bishopsâ⬠Bible or King James. It also brings him to the influence of The Book of Common Prayer. No one knows exactly how long William remained at the Stratford Grammar School but it is believed that an assistant of John Shakespeare forced him to withdraw William from thence. His later education must be the ways of business he would have learned around his fatherâ⬠s shop. Spectators said they have seen William give speeches to the calf before slaughtering them for his fatherâ⬠s leather work. William married Ann Hathwey in 1582. She was also from Stratford where William was born. Even though she was eight years older than he, their marriage was a success. Ann was three months in pregnancy when they were wed. Their first born Susanna was born in May 26, 1583. After that they had twins named after life time friends, Hamnet and Judeth Sadler. There wasnâ⬠t much talk from William about his marriage except some of his literature showed apparent resemblance of him and his wife. It seemed he was regarding him and his wife in some plays. There were no records of Shakespeareâ⬠s activities after the birth of his twins. We called it the lost years. It was believed that at those periods he was on refuge from a sort of crime. There wasnâ⬠t any hard evidence on his activities but there were many theories to fill in the time of activity. The mark of William Shakespeareâ⬠s rise in London theater world in 1592 on a famous literary by Robert Greene which clearly refers to William Shakespeare. Later there were many other playwrights and pamphleteer that made reference of William Shakespeareâ⬠s poetry and plays. As Shakespeare gone old he retired back to Avon. Where, his Judith and his son-in-law attended him. There was no accurate proof of Shakespeareâ⬠s death but in a diary half a century after his death it was said that Shakespeare died of over dose of alcohol. It is also expected that Shakespeare might have also known his death because days before he had his will revised. Almost a month after the revision on April 23, 1616 William Shakespeare past away. The end of a chapter in great literature. William Shakespeare Biography April 23 of 1564 the beginning to the path of great literature and performance, the birth of William Shakespeare, whose creations have affected everyone for generations. |He was born and raised in Stratford-upon-Avon. William was the third child out of eight from John and Mary Shakespeare. The names of the other seven children are Joan, Margaret, Gilbert, Joan, Ann, Richard and Edmund. Williamâ⬠s grandfather, Richard Shakespeare was a whittawer and a dealer in agricultural commodities. Richard died 52 days after the birth of William. William attended the Stratford Grammar School. Even though the record-of- attendance have been lost it is no doubt that he truly attended the school, since the school was built and maintained expressly for the purpose of education the sons of prominent citizens. Because William attended church, the other obvious education is the exposer to either the Geneva Bible or the Bishopsâ⬠Bible or King James. It also brings him to the influence of The Book of Common Prayer. No one knows exactly how long William remained at the Stratford Grammar School but it is believed that an assistant of John Shakespeare forced him to withdraw William from thence. His later education must be the ways of business he would have learned around his fatherâ⬠s shop. Spectators said they have seen William give speeches to the calf before slaughtering them for his fatherâ⬠s leather work. William married Ann Hathwey in 1582. She was also from Stratford where William was born. Even though she was eight years older than he, their marriage was a success. Ann was three months in pregnancy when they were wed. Their first born Susanna was born in May 26, 1583. After that they had twins named after life time friends, Hamnet and Judeth Sadler. There wasnâ⬠t much talk from William about his marriage except some of his literature showed apparent resemblance of him and his wife. It seemed he was regarding him and his wife in some plays. There were no records of Shakespeareâ⬠s activities after the birth of his twins. We called it the lost years. It was believed that at those periods he was on refuge from a sort of crime. There wasnâ⬠t any hard evidence on his activities but there were many theories to fill in the time of activity. The mark of William Shakespeareâ⬠s rise in London theater world in 1592 on a famous literary by Robert Greene which clearly refers to William Shakespeare. Later there were many other playwrights and pamphleteer that made reference of William Shakespeareâ⬠s poetry and plays. As Shakespeare gone old he retired back to Avon. Where, his Judith and his son-in-law attended him. There was no accurate proof of Shakespeareâ⬠s death but in a diary half a century after his death it was said that Shakespeare died of over dose of alcohol. It is also expected that Shakespeare might have also known his death because days before he had his will revised. Almost a month after the revision on April 23, 1616 William Shakespeare past away. The end of a chapter in great literature. thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-71780800586929235352020-01-10T04:17:00.001-08:002020-01-10T04:17:02.572-08:00The War Against Research Paper Thesis Statement The War Against Research Paper Thesis Statement At precisely the same time, thesis statements for different kinds of papers aren't the same. Depending on what sort of paper you're working on, your thesis could possibly be analytical, explanatory, or argumentative. The thesis can be included at the beginning of the paper. Understanding how to compose a research paper thesis provides you an upper hand in college. The Fundamentals of Research Paper Thesis Statement Revealed The very first thing which you should do is to define your essay type. The most essential part of any introduction is the thesis statement, as it can help you structure your entire paper. It is fine to return and reconsider the thesis statement so the last version fits the research paper the very best. The usual part of thesis vs. research paper is they're academic documents. If you attempt to acquire your studying to fit your thesis statement, then maybe it doesn't work out as neatly as you believe. Or you might have to revise your thesis to coordinate with the evidence and insights that you need to talk about. The tentative thesis will allow you to keep your facts on track. If you're writing a research paper, you shouldn't focus on over three variables, you ought to keep your thesis statement highly precise and always provide data for each claim you earn. The thesis statement is able to help you make certain that all your research and writing is linked to the objective of your writing. Your thesis should demonstrate that you have done your research and your paper is going to be an acceptable accounting of the topic. Writing a thesis demands deep wisdom and pro-level research abilities. The Start of Research Paper Thesis Statement A strong thesis statement is likely to make your reader want to find out more and help him understand what things to anticipate from the rest of your essay. Nowadays you have a working thesis! A great thesis falls somewhere between both extremes. It will therefore can make the difference between a good essay and a bad one. Research is an essential component of any college program. So, the students should see to it th at the thesis statement is all up to date. Research Paper Thesis Statement Fundamentals Explained All present kinds of essays have an outline to guarantee that the reader can understand everything. When you read the job of different writers, you can be in a position to be aware some errors and produce rectification when it regards your own. In the event you set the statement somewhere at the start of your introduction, by the time the reader gets to the body they would have forgotten it, that is the reason why it should come right after the introduction. You should offer a thesis early in your essay in the debut, or in longer essays in the second paragraph to be able to establish your position and provide your reader a feeling of direction. Knowing what it is that you're attempting to achieve, and committing it to paper, can be hard. As you work on your thesis, don't forget to keep the remainder of your paper in mind in any way times. Some researches discuss an overall topi c while some are managing something specific. To acquire an overall comprehension of what it is and the way that it should look like, search for examples of such statements online there are plenty of samples offered for reading and downloading so that you can locate many suitable examples. The genuine thesis statement is both precise and right to the point yet some explanation was given to elaborate the particulars of the study. Start out with a purpose statement that you'll later become a thesis statement. The statement needs to be arguable to draw the reader to the body. Much like a thesis statement, a purpose statement is situated at the close of the intro paragraph, or may choose the kind of another paragraph in big papers, including dissertations etc.. Whenever someone reads your thesis statement, they ought to acquire a feeling of what your paper is all about and what, if any, slant or argument you've got. A thesis statement is comprised of a couple of sentences that summarize the heart of your findings and explain what the aim of your paper is. The thesis proposal also takes a strong comprehension of the available resources in the specialty, and where to locate them. There are various ways and unique approaches to compose a thesis statement. If you opt to use the thesis statement suggested previously need to write 1 paragraph discussing a connection between literacy of population and financial development of the nation. A thesis statement is essential for a number of explanations. thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-2387367379683451122020-01-02T00:41:00.001-08:002020-01-02T00:41:02.649-08:00How The Current Restaurant Location Continues Working On A... The current restaurant location continues on its steady pace and the new restaurant location renovations have been completed. Now Michael and Tyler are in the process of making the dream a reality and have begun working on a final business plan punch-out. Michael and Tyler are reviewing their marketing, promotion, and campaign plans for the grand opening. They are in agreement that this business plan is heading in the correct direction, they have the media, website and social media venues ready to go and they are feeling comfortable to begin the soft opening to test this plan out. Michael and Tyler meet with their staff to conduct a final walk-through with the contractors to ensure all equipment is in place and functioningâ⬠¦show more contentâ⬠¦Michael and Tyler both realized how reliant the business is on technology and equipment and how they must safeguard it for themselves and the customers and what liability issues they face if not done. Issues: The current situation presents itself with issue to consider, first, is the grand opening of the new restaurant location and the continued smooth uninterrupted operation of the current restaurant, second, is dealing with the safeguarding of their equipment and data and developing a plan on how this will be accomplished. In looking deeper, regarding the point of sale system (POS) its servers and other organizational data, what safety measures should be implemented for loss of power, password protection, setting up firewalls to secure from hackers, recovery and mitigation. Not only does a business need to protect themselves in these matters but consideration needs to be given on how to protect the customers while using the restaurants Wi-Fi, its website and social media portals and spell out the terms of use so all parties involved are aware of the risks. In order to address some of these matters a comprehensive Risk Management Analysis should be performed like the example sh own in Figure 14.1 which will crosswalk you through the impact (high, medium and low) based on the questions you would have. Another matter needing to be addressed would be a Computer Resource need such as the example in Figure 14.2. (Figure thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-83928561707779271922019-12-24T20:25:00.001-08:002019-12-24T20:25:03.870-08:00The Impact Of Social Work On The Elderly - 1684 Words When you think about social work, you come to mind of professionals stepping in to help families, communities and organizations. I neglect consider the elderly and put them last in need of care and assistance. In terms of the idea about social work with the elderly it has a small impact. The role of the social worker has a part of administrative requirements. Throughout the period of time and development of social work there is casework that deal with the elderly. The practice of this that deal with the elderly had very little recognition until it was carried out by the National Health Service and Community Care Act 1990 (Jordan, 2005, pp. 43). Social work in Canadian seniors is that the aging can be attributed to the three factors thatâ⬠¦show more contentâ⬠¦This shows that Canada does excellent benefit services and welfare of the elderly that are low income. The Canada Pension Plan (CPP) retirement pension provides a monthly benefit to eligible applicants. Also, the Private pension plans provide workers with retirement income to increase their income from public pension plans. Many business pension funds now underfunded; may be unable to pay out to retirees. There is concern that Old Age Security/Guaranteed Income Supplement are no longer adequate. Since 2008 financial crisis led to drop in value of RRSP investments. This challenges the pension system and the elderly that need social assistance and a way of living becomes more difficult in the process. Life expectancy has doubled over the past 100 years. Majority of seniors do not engage in behaviours harmful to their health. There is a health gap between seniors with low incomes and those with higher incomes. Seniors face a number of common issues: Inactivity, accidents, victims of fraud and mandatory retirement. Elder abuse and neglect of seniors is the mistreatment of older people by those in a position of trust, power, or responsibility for their care. Neglect is frequently associated with abuse. Abuse may take place in the home or institutional setting. Institutional Abuse is any act or omission directed at a resident that causes the person harm, or that wrongfully deprives that person of his or her independence. Social work in the long term care settingsShow MoreRelatedPeopleââ¬â¢s Experiences of Death and Dying Are Profoundly Affected by Social and Cultural Differences.1570 Words à |à 7 PagesIntroduction Peopleââ¬â¢s experiences of death and dying are profoundly affected by social and cultural differences. Socio-economic factors such as standard of living, economic infrastructure, diet, environmental disasters, war, sexual pervasiveness, disease etc all interconnect to affect the way in which they frame an individualââ¬â¢s experience of death and dying. The unequal distribution of resource throughout the world and the differing levels of food shortage, disease, war and natural disasters needRead MoreThe Role Of A Social Worker And The Elderly Population957 Words à |à 4 PagesSocial work is a profession that focuses on all ages, ethnicities, and culture. The role of a social worker includes core values, human rights, social justice and problem solving. When I chose to seek a degree in social work I did not know all of the ramifications that would follow. However, I did know that I wanted to work with children. The day I became a mother I knew it was my purpose to eventually work with children in some capacity. Once I started taking pre-social work classes I learned soRead MoreTh e Effects Of Media On Children s Mental And Physical Health1228 Words à |à 5 Pages2010 (AARP) . There are many risks that isolation causes for everyone but it is even more detrimental to the elderly. Major risks from isolation are an increased risk of mortality adults aged 52 older along having a large impact in high blood pressure (social). This is due to the crippling effects that isolation can have on a personââ¬â¢s mental and physical health. There are several academic works that support these claims because of the overall risks that isolation poses on everyoneââ¬â¢s health. While isolationRead MoreEssay on Market Forces Affecting The Long-Term Care Industry1585 Words à |à 7 Pagesof the markets in which they operate and to re-evaluate their marketing strategies. Demographic shifts, sociological phenomena, medical advances, new government influences and competition are impacting the manner in which care is provided to the elderly and subsequently creating changes in consumer expectations and demands for long-term care services. As with any industry in a period of transition, changes will create new business opportunities for those who understand and capitalize on changingRead MoreImpacts of an Aging Population1406 Words à |à 6 PagesThe impacts of an aging population on a country An aging population is where the population of a country is of a high elderly dependence. There are three main ways to split the ways they are sorted and these are Social, the ways in which the elderly population affect the people around them, political, the ways in which the elderly population affect the politics of a country, and finally, economic, the ways in which the elderly population affect the wealth of the country. Social impacts can beRead MoreThe Lingering Effects of Stereotyping831 Words à |à 3 Pagesfocus are: women are untrustworthy; all White Americans are rich; and the elderly population is useless. The first stereotype is that women cannot be trusted. Often arguments to support this stereotype come from media representation in television, film, and otherwise. Women are often represented as liars who have intercourse outside of marriage or a relationship. Women are also represented as duplicitous among their social circles, particularly while a part of peers groups consisting of only womenRead MoreIncrease in Elderly Population Report826 Words à |à 3 Pageslongevity. This increase in the elderly population can be seen around the world and will have a significant impact on medical institutions, society, and the economy. As we grow older, our immune system begins to deteriorate in one of two ways. It can become negligent, allowing abnormal cells such as cancer cells to multiply/grow unchecked. Or it may become overzealous; attacking our normal tissues much like an autoimmune disease. This deterioration is what causes the elderly to become more pronged toRead MoreThe Effects Of Ageism On The Delivery Of Nursing Care For The Older Person1736 Words à |à 7 PagesThe aim of this essay is to provide the audience with an understanding of ageism in healthcare by critically analyzing the impact of ageism on the delivery of nursing care for the older person. This essay will be based from the perspective of the impact of a registered nurseââ¬â¢s ageist behaviour on the older patient, the nursing care of the older patient and the impact on colleagues in the health care team. This essay will also discuss theories and relevant principles of ageism, nursing care andRead MoreRetirement Is A Transitional Ph ase Associated With An Aging Population1692 Words à |à 7 Pagesthe elderly that is forced to work well past the age of retirement. In reality, most elderly cannot work, and those who can work, live in or near poverty. Such social issues can be attributed to the government. For example, the huge federal deficit which threatens the quality of life for retirees. The social security program which promises benefits for retirees, that is not affordable. Medical insurance program cuts that will impact healthcare for retirees. These are just some of the social issuesRead MoreSocial Policies : A Policy s Success Or Failures1286 Words à |à 6 Pages There are different approaches and methods used to evaluate social policies. Social policies can be evaluated for many reasons including: tracking a policyââ¬â¢s progression or tracing a policyââ¬â¢s successes or failures. There is limited research concerning any significant differences in how social policies are evaluated in terms of method, compared to other policies such health or public policy. Yet the approach to designing of a particularly can subjective during an evaluation in terms of what exactly thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0tag:blogger.com,1999:blog-2462408670397837421.post-46254817281882629772019-12-16T16:55:00.001-08:002019-12-16T16:55:02.304-08:00Analyse How the Film ââ¬ËThe Matrixââ¬â¢ presents two Different Versions of Reality Free Essays We are presented with two different versions of reality. In one we get the feeling of everything being enclosed and lifeless, this is the Matrix which is a computer program designed as a trap for human minds. In it people have no individuality; they are all just part of the system. We will write a custom essay sample on Analyse How the Film ââ¬ËThe Matrixââ¬â¢ presents two Different Versions of Reality or any similar topic only for you Order Now The other reality is a harsh post apocalyptic one where computers have enslaved humanity and the sky is dark. This reality is when humans are conscious and no longer part of the Matrix. In the first scene I analysed the, the camera moves along a split section of a wall next to Neoââ¬â¢s office until he comes into view. This reminds us that there are walls all around and he is enclosed, this is important because it shows that in the Matrix people are enclosed to make them easier to control. The office he is in is very bland and the lighting is subdued to give the feeling of oppression, this demonstrates how the Matrix has been designed to be dull and uninspiring. The walls parting the office Neo works in are very short allowing people to see over them, this gives the impression of being watched all the time. When the delivery man enters the scene and gives Neo the package it is all done in a monotonous way. Neo and the delivery man do not make eye contact and even when the delivery man talks to Neo he does so in an emotionless way. This accentuates how people in the Matrix act like machines and tend not to show much human emotion. Neo opens the package to find a mobile phone inside. The phone rings as soon as neo opens it, this makes it seem like whoever is phoning him is watching him. When Neo answers the phone music starts, it is a fast beat but not very loud, this builds tension and helps make the mood more exciting. Morpheus speaks to Neo and tells him to look over his office wall, as he does this, the camera cuts to what he is looking at. Neo sees the agents talking to a woman. The music turns into a dramatic drum roll as the agents come into view; this builds drama in the scene and shows that the agents are not good. The agents are wearing black suits which contrast against the cream walls of the office and normal clothes everyone else are wearing. This shows us that they are important and not just normal people. The agents also wear sunglasses, eyes are an important part of the human face and are in some cultures said to be windows to the soul. By dressing the agents in sunglasses I think the director intended to make them less human and without a soul like machines. The agents all turn their heads in unison to look at Neo, this is very abnormal and creepy, and it makes them look as though they are all one unit. Neo quickly ducks down to stop the agents from seeing him. We see Neo crouching on the phone; the camera gives us an aerial view of Neo. The way we see him crouching in the corner of his office with no where to escape, like a caged animal is like a metaphor for the Matrix being like a Zoo for humans. As Neo leaps into a cubical on instruction from Morpheus the music slows down and Neo hides in a dark corner. The slow music makes the audience relax slightly and the dark lights emphasises that Neo is hiding away. As Neo then runs around the office the music gets much faster and builds excitement and energy. The camera tracks Neo as he runs away which makes the office look like a maze. The maze could also be interpreted as the Matrix with Morpheus is guiding him out of to escape from the agents, this mirrors what happens in the film when Morpheus really does guide Neo out of the Matrix. I think that by making the Matrix look like a dull, lifeless place the directors were trying to show us that the matrix was designed to be un-stimulating and mind controlling to stop people questioning their reality, so they donââ¬â¢t realise that they are in the Matrix and learn how to control it to escape. The program gives people just enough stimulation to keep their minds occupied while the computers use their bodies for energy. When the scene on Morpheusââ¬â¢s ship first starts the screen is black and we hear Morpheusââ¬â¢s voice. This makes it feel as if we are hearing him through the ears of someone who is asleep. The light then gets very bright then fades to a shot of Trinity. The way the light is very bright then fades makes it seem like someone waking up because when you open your eyes after a deep sleep everything seems too bright and hurts your eyes. The shot of Trinity comes from an angle where Neo is laying which makes it seem like we are seeing her through his eyes. We then see an aerial view of Neoââ¬â¢s head. He looks very pale and the bed he is laying on is a dark background which makes a contrast to his pale skin, this shows us that he hasnââ¬â¢t been exposed to any or much light. He also has no hair with shows he hasnââ¬â¢t been growing properly. The fact that he has no hair and is pale also makes him look like a new born baby, this metaphorically expresses how being taken out of the Matrix and coming into the real world is like being reborn. When we see the machines he is being monitored by he looks like a new born baby being kept in an incubator which demonstrates how weak he must be. The music is much slower and calmer in contrast to the fast energetic music that is heard in the matrix. This could be because time is more real in this world and is passing slower. As the camera cuts to different shots of Neo it fades out to black then back in, this could be portraying how time is moving slowly. The fading could also be Neo fading in and out of consciousness. It could have been intended by the directors to look like a hallucinatory affect, as if Neo was dreaming and only semi-conscious. When we see the side shot of Neo we see lots of long needles protruding from his body. The needles reminisce ones used in acupuncture which is an ancient art, mixed with a blue light that shines on Neo to give a futuristic feel. This illustrates the very old mixing with the new to impress upon the audience how science and medicine have moved on and become more advanced through the years, but not forgotten the old techniques like acupuncture. When Neo talks to Morpheus we see he has grown some hair, this shows us that a lot of time has passed. The music is very calm which sets a mood of security. The camera tracks along Neoââ¬â¢s body showing all of the holes and instruments sticking out of him, this shows us that Neo has never used his muscles before so the medical equipment is helping him grow some faster. The fact that he has things sticking in his skin and going beneath the skin show us how things are real, but in the Matrix people are just digital projections of their minds. Itââ¬â¢s like when you pinch yourself to make sure you are not dreaming. The scene ends by fading to black again which could mean Neo is drifting out of consciousness or that time is passing. How to cite Analyse How the Film ââ¬ËThe Matrixââ¬â¢ presents two Different Versions of Reality, Papers thersbersdarve1981http://www.blogger.com/profile/15119093099516504313noreply@blogger.com0